Miyakogusa Predicted Gene
- Lj0g3v0239159.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0239159.1 tr|Q9T0N0|Q9T0N0_PEA 14-3-3-like protein OS=Pisum
sativum GN=14-3-3 PE=2 SV=1,99.14,0,no description,14-3-3 domain;
1433_2,14-3-3 protein, conserved site; 1433ZETA,14-3-3 protein;
14-3-3,CUFF.15716.1
(351 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 696 0.0
gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 381 e-105
gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 p... 381 e-105
gnl|LJGI|TC58444 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-lik... 343 4e-94
gnl|LJGI|TC76301 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-lik... 335 1e-91
gnl|LJGI|DC595627 similar to UniRef100_Q75ZD3 Cluster: 14-3-3 i-... 186 6e-47
gnl|LJGI|DC595772 similar to UniRef100_Q1AP39 Cluster: 14-3-3 pr... 101 3e-21
gnl|LJGI|TC81325 similar to UniRef100_Q9XEW4 Cluster: 14-3-3 pro... 88 4e-17
gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 pro... 82 3e-15
gnl|LJGI|TC82153 homologue to UniRef100_Q5KSB6 Cluster: Hypersen... 72 2e-12
gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 p... 64 6e-10
gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 p... 60 1e-08
gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-l... 60 1e-08
gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-... 56 1e-07
gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3... 56 1e-07
gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 p... 56 1e-07
gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 p... 54 6e-07
>gnl|LJGI|TC72258 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), complete
Length = 1300
Score = 696 bits (351), Expect = 0.0
Identities = 351/351 (100%)
Strand = Plus / Plus
Query: 1 atgaagggagattaccataggtatctggctgagtttaagaccggcgctgagcgtaaggag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 522 atgaagggagattaccataggtatctggctgagtttaagaccggcgctgagcgtaaggag 581
Query: 61 gccgctgagagcaccctcgccgcttacaaatctgctcaggatattgcaaattcagaactg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 582 gccgctgagagcaccctcgccgcttacaaatctgctcaggatattgcaaattcagaactg 641
Query: 121 ccaccaactcatccaattaggctcggccttgctctgaatttctctgtgttttattacgag 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 642 ccaccaactcatccaattaggctcggccttgctctgaatttctctgtgttttattacgag 701
Query: 181 attctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttgacgaagcgatt 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 702 attctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttgacgaagcgatt 761
Query: 241 gctgaattggataccttgggagaggaatcatacaaggatagcactttgatcatgcaactt 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 762 gctgaattggataccttgggagaggaatcatacaaggatagcactttgatcatgcaactt 821
Query: 301 cttcgtgataacctcaccctctggacctccgacatgcaggatgatggagca 351
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822 cttcgtgataacctcaccctctggacctccgacatgcaggatgatggagca 872
>gnl|LJGI|TC75963 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), complete
Length = 1048
Score = 381 bits (192), Expect = e-105
Identities = 306/344 (88%)
Strand = Plus / Plus
Query: 1 atgaagggagattaccataggtatctggctgagtttaagaccggcgctgagcgtaaggag 60
|||||||| |||||||||||||||||||||||||| |||||||| ||||| | || ||
Sbjct: 557 atgaagggcgattaccataggtatctggctgagttcaagaccggtactgagaggaaagac 616
Query: 61 gccgctgagagcaccctcgccgcttacaaatctgctcaggatattgcaaattcagaactg 120
|| ||||||||||| || || ||||||||||||||||||||||||||||| || || |||
Sbjct: 617 gctgctgagagcactcttgctgcttacaaatctgctcaggatattgcaaactctgagctg 676
Query: 121 ccaccaactcatccaattaggctcggccttgctctgaatttctctgtgttttattacgag 180
|| || ||||| || || ||||| |||||||||||||| |||||||||||||| || |||
Sbjct: 677 cctcctactcacccgatcaggctgggccttgctctgaacttctctgtgttttactatgag 736
Query: 181 attctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttgacgaagcgatt 240
||||| ||||||||||| || || |||| ||| ||||||||||||||||| || || |||
Sbjct: 737 attctgaactctcctgaccgagcttgcagccttgcaaaacaggcttttgatgaggccatt 796
Query: 241 gctgaattggataccttgggagaggaatcatacaaggatagcactttgatcatgcaactt 300
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 797 gctgaattggatacattgggagaggagtcatacaaggatagcactttgatcatgcaactt 856
Query: 301 cttcgtgataacctcaccctctggacctccgacatgcaggatga 344
|| ||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 857 ctccgtgataacctcaccctttggacctctgacatgcaggatga 900
>gnl|LJGI|TC66817 homologue to UniRef100_Q93XW1 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), partial (61%)
Length = 741
Score = 381 bits (192), Expect = e-105
Identities = 306/344 (88%)
Strand = Plus / Plus
Query: 1 atgaagggagattaccataggtatctggctgagtttaagaccggcgctgagcgtaaggag 60
|||||||| |||||||||||||||||||||||||| |||||||| ||||| | || ||
Sbjct: 86 atgaagggcgattaccataggtatctggctgagttcaagaccggtactgagaggaaagac 145
Query: 61 gccgctgagagcaccctcgccgcttacaaatctgctcaggatattgcaaattcagaactg 120
|| ||||||||||| || || ||||||||||||||||||||||||||||| || || |||
Sbjct: 146 gctgctgagagcactcttgctgcttacaaatctgctcaggatattgcaaactctgagctg 205
Query: 121 ccaccaactcatccaattaggctcggccttgctctgaatttctctgtgttttattacgag 180
|| || ||||| || || ||||| |||||||||||||| |||||||||||||| || |||
Sbjct: 206 cctcctactcacccgatcaggctgggccttgctctgaacttctctgtgttttactatgag 265
Query: 181 attctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttgacgaagcgatt 240
||||| ||||||||||| || || |||| ||| ||||||||||||||||| || || |||
Sbjct: 266 attctgaactctcctgaccgagcttgcagccttgcaaaacaggcttttgatgaggccatt 325
Query: 241 gctgaattggataccttgggagaggaatcatacaaggatagcactttgatcatgcaactt 300
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 326 gctgaattggatacattgggagaggagtcatacaaggatagcactttgatcatgcaactt 385
Query: 301 cttcgtgataacctcaccctctggacctccgacatgcaggatga 344
|| ||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 386 ctccgtgataacctcaccctttggacctctgacatgcaggatga 429
>gnl|LJGI|TC58444 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-like protein; n=1;
Pisum sativum|Rep: 14-3-3-like protein - Pisum sativum
(Garden pea), partial (96%)
Length = 1248
Score = 343 bits (173), Expect = 4e-94
Identities = 266/297 (89%)
Strand = Plus / Plus
Query: 50 agcgtaaggaggccgctgagagcaccctcgccgcttacaaatctgctcaggatattgcaa 109
||||||||||| | |||||||||||| | | |||||||||||||| |||||||||| |
Sbjct: 570 agcgtaaggagtctgctgagagcaccttagttgcttacaaatctgccgaggatattgcta 629
Query: 110 attcagaactgccaccaactcatccaattaggctcggccttgctctgaatttctctgtgt 169
|| ||||||| | ||||||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 630 atgcagaacttgctccaactcatccaattaggctcggtcttgctctgaacttctctgtgt 689
Query: 170 tttattacgagattctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttg 229
|||| || || ||||||||||||||||||||||||||||| |||||||| | ||||| |
Sbjct: 690 tttactatgaaattctcaactctcctgatcgtgcctgcaaaatcgcaaaagacgctttcg 749
Query: 230 acgaagcgattgctgaattggataccttgggagaggaatcatacaaggatagcactttga 289
| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 atgaagcgatatctgaattggataccttgggagaggaatcatacaaggatagcactttga 809
Query: 290 tcatgcaacttcttcgtgataacctcaccctctggacctccgacatgcaggatgatg 346
||||||||||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 810 tcatgcaacttcttcgtgataacctcaccctttggacctctgaggtggaggatgatg 866
>gnl|LJGI|TC76301 similar to UniRef100_Q9T0N0 Cluster: 14-3-3-like protein; n=1;
Pisum sativum|Rep: 14-3-3-like protein - Pisum sativum
(Garden pea), partial (94%)
Length = 1142
Score = 335 bits (169), Expect = 1e-91
Identities = 265/297 (89%)
Strand = Plus / Plus
Query: 50 agcgtaaggaggccgctgagagcaccctcgccgcttacaaatctgctcaggatattgcaa 109
||||||||||| | |||||||||||| | | |||||||||||||| |||||||||| |
Sbjct: 591 agcgtaaggagtctgctgagagcaccttagttgcttacaaatctgccgaggatattgcta 650
Query: 110 attcagaactgccaccaactcatccaattaggctcggccttgctctgaatttctctgtgt 169
|| ||||||| | ||||||||||| ||||||||||| ||||||||||| ||||||||||
Sbjct: 651 atgcagaacttgctccaactcatcccattaggctcggtcttgctctgaacttctctgtgt 710
Query: 170 tttattacgagattctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttg 229
|||| || || ||||||||||||||||||||||||||||| |||||||| | ||||| |
Sbjct: 711 tttactatgaaattctcaactctcctgatcgtgcctgcaaaatcgcaaaagacgctttcg 770
Query: 230 acgaagcgattgctgaattggataccttgggagaggaatcatacaaggatagcactttga 289
| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 771 atgaagcgatatctgaattggataccttgggagaggaatcatacaaggatagcactttga 830
Query: 290 tcatgcaacttcttcgtgataacctcaccctctggacctccgacatgcaggatgatg 346
||||||||||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 831 tcatgcaacttcttcgtgataacctcaccctttggacctctgaggtggaggatgatg 887
>gnl|LJGI|DC595627 similar to UniRef100_Q75ZD3 Cluster: 14-3-3 i-2 protein; n=1;
Nicotiana tabacum|Rep: 14-3-3 i-2 protein - Nicotiana
tabacum (Common tobacco), partial (30%)
Length = 299
Score = 186 bits (94), Expect = 6e-47
Identities = 178/206 (86%)
Strand = Plus / Minus
Query: 124 ccaactcatccaattaggctcggccttgctctgaatttctctgtgttttattacgagatt 183
|||||||||||||||||||| || ||||||||||| ||||||| |||||| || || |||
Sbjct: 299 ccaactcatccaattaggctgggtcttgctctgaacttctctgggttttactaggaaatt 240
Query: 184 ctcaactctcctgatcgtgcctgcaacctcgcaaaacaggcttttgacgaagcgattgct 243
||||||||||||||||||||| |||| | |||||| ||||||| || |||| ||| ||
Sbjct: 239 ctcaactctcctgatcgtgccggcaaaatggcaaaagaggctttggaggaagggatatct 180
Query: 244 gaattggataccttgggagaggaatcatacaaggatagcactttgatcatgcaacttctt 303
|||| |||||||| ||| ||||||||||||| |||| |||||| ||||| ||||||||||
Sbjct: 179 gaatgggatacctggggggaggaatcatacagggatggcacttggatcaggcaacttctt 120
Query: 304 cgtgataacctcaccctctggacctc 329
| |||||||||||||| |||||||
Sbjct: 119 ggggataacctcacccttgggacctc 94
>gnl|LJGI|DC595772 similar to UniRef100_Q1AP39 Cluster: 14-3-3 protein; n=1; Manihot
esculenta|Rep: 14-3-3 protein - Manihot esculenta
(Cassava) (Manioc), partial (11%)
Length = 400
Score = 101 bits (51), Expect = 3e-21
Identities = 66/71 (92%)
Strand = Plus / Minus
Query: 276 ggatagcactttgatcatgcaacttcttcgtgataacctcaccctctggacctccgacat 335
||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
Sbjct: 400 ggatagcactttgatcatgcaacttcttcgtgataacctcaccctttggacctctgaggt 341
Query: 336 gcaggatgatg 346
| |||||||||
Sbjct: 340 ggaggatgatg 330
>gnl|LJGI|TC81325 similar to UniRef100_Q9XEW4 Cluster: 14-3-3 protein; n=1; Populus
tremula x Populus alba|Rep: 14-3-3 protein - Populus
tremula x Populus alba, partial (15%)
Length = 405
Score = 87.7 bits (44), Expect = 4e-17
Identities = 66/72 (91%), Gaps = 1/72 (1%)
Strand = Plus / Plus
Query: 258 gggagaggaatcatac-aaggatagcactttgatcatgcaacttcttcgtgataacctca 316
||||||||| |||||| |||||||||||||||||||||| |||||| |||||| ||||||
Sbjct: 1 gggagaggagtcataccaaggatagcactttgatcatgccacttctccgtgattacctca 60
Query: 317 ccctctggacct 328
|||| |||||||
Sbjct: 61 ccctttggacct 72
>gnl|LJGI|TC66180 similar to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
Lilium longiflorum (Trumpet lily), partial (98%)
Length = 1252
Score = 81.8 bits (41), Expect = 3e-15
Identities = 122/149 (81%)
Strand = Plus / Plus
Query: 148 cttgctctgaatttctctgtgttttattacgagattctcaactctcctgatcgtgcctgc 207
|||||||| || |||||||| |||||||||||||| | ||||||||||| | ||||||
Sbjct: 607 cttgctctcaacttctctgtcttttattacgagatcatgaactctcctgaaagggcctgc 666
Query: 208 aacctcgcaaaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaa 267
| | || ||||| |||||||| || || ||||| || ||||| |||||| | || ||
Sbjct: 667 catttggctaaacaagcttttgatgaggcaattgcagagttggacaccttgagtgaagag 726
Query: 268 tcatacaaggatagcactttgatcatgca 296
||||||||||| || ||||||||||||||
Sbjct: 727 tcatacaaggacagtactttgatcatgca 755
>gnl|LJGI|TC82153 homologue to UniRef100_Q5KSB6 Cluster: Hypersensitive-induced
response protein; n=1; Lotus japonicus|Rep:
Hypersensitive-induced response protein - Lotus
japonicus, partial (19%)
Length = 596
Score = 71.9 bits (36), Expect = 2e-12
Identities = 45/48 (93%)
Strand = Plus / Plus
Query: 297 acttcttcgtgataacctcaccctctggacctccgacatgcaggatga 344
|||||| ||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 235 acttctccgtgataacctcaccctttggacctctgacatgcaggatga 282
>gnl|LJGI|TC59299 homologue to UniRef100_A3RG89 Cluster: 14-3-3 protein Lil 1433-2;
n=1; Lilium longiflorum|Rep: 14-3-3 protein Lil 1433-2 -
Lilium longiflorum (Trumpet lily), partial (94%)
Length = 1181
Score = 63.9 bits (32), Expect = 6e-10
Identities = 68/80 (85%)
Strand = Plus / Plus
Query: 217 aaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaatcatacaag 276
||||| ||||| || || ||||||||||| || || |||||| | || || |||||||||
Sbjct: 676 aaacaagctttcgatgaggcgattgctgagttagacaccttgagtgaagagtcatacaag 735
Query: 277 gatagcactttgatcatgca 296
|| |||||||||||||||||
Sbjct: 736 gacagcactttgatcatgca 755
>gnl|LJGI|TC78948 homologue to UniRef100_Q9LKL0 Cluster: 14-3-3 protein; n=1; Populus
tremula x Populus alba|Rep: 14-3-3 protein - Populus
tremula x Populus alba, partial (56%)
Length = 633
Score = 60.0 bits (30), Expect = 1e-08
Identities = 198/254 (77%)
Strand = Plus / Plus
Query: 82 gcttacaaatctgctcaggatattgcaaattcagaactgccaccaactcatccaattagg 141
||||||||||| |||||||||||||| | | ||||| | || || || || ||||||
Sbjct: 120 gcttacaaatcagctcaggatattgctcttgctgaacttgcccccacccacccgattagg 179
Query: 142 ctcggccttgctctgaatttctctgtgttttattacgagattctcaactctcctgatcgt 201
||||| ||||| || || || |||||||| || || || || || ||||| || ||||||
Sbjct: 180 ctcggtcttgcactcaacttttctgtgttctactatgaaatccttaactcgccagatcgt 239
Query: 202 gcctgcaacctcgcaaaacaggcttttgacgaagcgattgctgaattggataccttggga 261
|| || || || || || ||||| ||||| || |||||| |||| | || || |||||
Sbjct: 240 gcttgtaatcttgcgaagcaggcatttgatgaggcgatttctgagcttgacacattgggt 299
Query: 262 gaggaatcatacaaggatagcactttgatcatgcaacttcttcgtgataacctcaccctc 321
|| || ||||||||||| | || ||||||||||| ||||| || ||||| || ||| |
Sbjct: 300 gaagagtcatacaaggacggtacattgatcatgcagcttctccgagataatctgaccttg 359
Query: 322 tggacctccgacat 335
||||| ||||||||
Sbjct: 360 tggacgtccgacat 373
>gnl|LJGI|TC58357 homologue to UniRef100_Q96450 Cluster: 14-3-3-like protein A; n=1;
Glycine max|Rep: 14-3-3-like protein A - Glycine max
(Soybean), complete
Length = 1153
Score = 60.0 bits (30), Expect = 1e-08
Identities = 180/230 (78%)
Strand = Plus / Plus
Query: 82 gcttacaaatctgctcaggatattgcaaattcagaactgccaccaactcatccaattagg 141
||||||||||| |||||||||||||| | | ||||| | || || || || ||||||
Sbjct: 536 gcttacaaatcagctcaggatattgctcttgctgaacttgcccccacccacccgattagg 595
Query: 142 ctcggccttgctctgaatttctctgtgttttattacgagattctcaactctcctgatcgt 201
||||| ||||| || || || |||||||| || || || || || ||||| || ||||||
Sbjct: 596 ctcggtcttgcactcaacttttctgtgttctactatgaaatccttaactcgccagatcgt 655
Query: 202 gcctgcaacctcgcaaaacaggcttttgacgaagcgattgctgaattggataccttggga 261
|| || || || || || ||||| ||||| || |||||| |||| | || || |||||
Sbjct: 656 gcttgtaatcttgcgaagcaggcatttgatgaggcgatttctgagcttgacacattgggt 715
Query: 262 gaggaatcatacaaggatagcactttgatcatgcaacttcttcgtgataa 311
|| || ||||||||||| || || ||||||||||| ||||| || |||||
Sbjct: 716 gaagagtcatacaaggacagtacattgatcatgcagcttctccgagataa 765
>gnl|LJGI|GO035957 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
bean), partial (80%)
Length = 748
Score = 56.0 bits (28), Expect = 1e-07
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 217 aaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaatcatacaag 276
|||||||| ||||| ||||| |||||||| |||| ||||||||||| ||||| |||||
Sbjct: 585 aaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcctacaaa 644
Query: 277 gatagcac 284
|| |||||
Sbjct: 645 gacagcac 652
>gnl|LJGI|TC69963 homologue to UniRef100_Q9FXL2 Cluster: Vf14-3-3c protein; n=1;
Vicia faba|Rep: Vf14-3-3c protein - Vicia faba (Broad
bean), partial (94%)
Length = 1199
Score = 56.0 bits (28), Expect = 1e-07
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 217 aaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaatcatacaag 276
|||||||| ||||| ||||| |||||||| |||| ||||||||||| ||||| |||||
Sbjct: 832 aaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcctacaaa 891
Query: 277 gatagcac 284
|| |||||
Sbjct: 892 gacagcac 899
>gnl|LJGI|TC68574 homologue to UniRef100_Q93XW2 Cluster: 14-3-3 protein; n=1; Vigna
angularis|Rep: 14-3-3 protein - Phaseolus angularis
(Adzuki bean) (Vigna angularis), partial (42%)
Length = 583
Score = 56.0 bits (28), Expect = 1e-07
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 217 aaacaggcttttgacgaagcgattgctgaattggataccttgggagaggaatcatacaag 276
|||||||| ||||| ||||| |||||||| |||| ||||||||||| ||||| |||||
Sbjct: 173 aaacaggcatttgaggaagcaattgctgagctggacaccttgggagaagaatcctacaaa 232
Query: 277 gatagcac 284
|| |||||
Sbjct: 233 gacagcac 240
>gnl|LJGI|TC75094 homologue to UniRef100_O49152 Cluster: 14-3-3 protein homolog; n=1;
Maackia amurensis|Rep: 14-3-3 protein homolog - Maackia
amurensis, complete
Length = 1280
Score = 54.0 bits (27), Expect = 6e-07
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 268 tcatacaaggatagcactttgatcatgcaacttct 302
|||||||| |||||||| |||||||||||||||||
Sbjct: 732 tcatacaaagatagcaccttgatcatgcaacttct 766