Miyakogusa Predicted Gene

Lj0g3v0237179.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0237179.1 Non Chatacterized Hit- tr|J4G0Z3|J4G0Z3_9APHY
Uncharacterized protein OS=Fibroporia radiculosa PE=4
,32,1.1,seg,NULL,CUFF.15534.1
         (385 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72595 similar to UniRef100_Q4T334 Cluster: Chromosome...   198   2e-50
gnl|LJGI|TC81783                                                       70   1e-11

>gnl|LJGI|TC72595 similar to UniRef100_Q4T334 Cluster: Chromosome undetermined
           SCAF10125, whole genome shotgun sequence; n=1; Tetraodon
           nigroviridis|Rep: Chromosome undetermined SCAF10125,
           whole genome shotgun sequence - Tetraodon nigroviridis
           (Green puffer), partial (4%)
          Length = 485

 Score =  198 bits (100), Expect = 2e-50
 Identities = 141/152 (92%), Gaps = 2/152 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttatgggttcatcatcttgctggatcttggaagaaaaatgggagaaaaaagttgt- 59
           |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 152 atgtttatgggttcct-atcttgctggatcttggaagaaaaatgggagaaaaaagttgtt 94

                                                                       
Query: 60  aactttctcagattcgagttttttgggattgggtaaaggagggattgaggaagatgatga 119
           |||||||||| ||  | |||||| || ||||||| ||||||||||||||||||| |||||
Sbjct: 93  aactttctcaaatctgggtttttgggaattgggtgaaggagggattgaggaagaagatga 34

                                           
Query: 120 tgaagaagggggaggagatgaaaagaaaccca 151
           ||||||||||||||||||||||||||||||||
Sbjct: 33  tgaagaagggggaggagatgaaaagaaaccca 2


>gnl|LJGI|TC81783 
          Length = 977

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 54/59 (91%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                      
Query: 16  tcatcttgctggatcttggaagaaaaatgggagaaaaaagttg-taactttctcagatt 73
           ||||||||||||| |||||| ||| ||||||||| |||||||| |||||||||||||||
Sbjct: 396 tcatcttgctggaacttggatgaacaatgggagagaaaagttgttaactttctcagatt 454