Miyakogusa Predicted Gene

Lj0g3v0235899.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0235899.1 Non Chatacterized Hit- tr|D7TEQ6|D7TEQ6_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,26.61,1e-18,PPR: pentatricopeptide repeat domain,Pentatricopeptide
repeat; seg,NULL; PPR,Pentatricopeptide repea,CUFF.15444.1
         (958 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS326911 similar to UniRef100_A7PRT7 Cluster: Chromosom...    52   7e-06
gnl|LJGI|TC58694 homologue to UniRef100_Q9SHF0 Cluster: T19E23.1...    52   7e-06

>gnl|LJGI|FS326911 similar to UniRef100_A7PRT7 Cluster: Chromosome chr14 scaffold_27,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_27, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (18%)
          Length = 616

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 474 ggtgttcgatgaaatgcgtgagagggatgt 503
           |||||||||||||||||||||||| |||||
Sbjct: 525 ggtgttcgatgaaatgcgtgagagagatgt 554


>gnl|LJGI|TC58694 homologue to UniRef100_Q9SHF0 Cluster: T19E23.10; n=1; Arabidopsis
           thaliana|Rep: T19E23.10 - Arabidopsis thaliana
           (Mouse-ear cress), partial (5%)
          Length = 777

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 474 ggtgttcgatgaaatgcgtgagaggg 499
           ||||||||||||||||||||||||||
Sbjct: 586 ggtgttcgatgaaatgcgtgagaggg 611