Miyakogusa Predicted Gene

Lj0g3v0234739.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0234739.1 Non Chatacterized Hit- tr|G7IU59|G7IU59_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,42.37,0.0001,
,CUFF.15347.1
         (222 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL...    80   6e-15
gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Ea...    60   6e-09

>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
           Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
           (Yeast) (Eremothecium gossypii), partial (8%)
          Length = 691

 Score = 79.8 bits (40), Expect = 6e-15
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                       
Query: 119 ctgaagagaagaagttctcggaggctgagatggctttgacgggagatgctttcttctggt 178
           ||||||||||||| ||||| ||||| |||| ||  |||||| | ||||| ||||| ||||
Sbjct: 628 ctgaagagaagaaattctcagaggcagagaaggtgttgacgcgtgatgcgttcttttggt 569

                                                       
Query: 179 ggtatttctggaaaagaagaaaccagaatgcaaaatggtgggat 222
           |||||| |||||||| | |||| ||||  |||||||||||||||
Sbjct: 568 ggtattcctggaaaaaacgaaatcagagggcaaaatggtgggat 525


>gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Early growth response
           protein 1; n=2; Mus musculus|Rep: Early growth response
           protein 1 - Mus musculus (Mouse), partial (4%)
          Length = 479

 Score = 60.0 bits (30), Expect = 6e-09
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 88  gtggagcagcactgtgaggccatggaaatggctgaagagaagaagttctcggaggctgag 147
           |||||||| ||||||||||||| || | |  | |||||| |||| ||||| | ||| |||
Sbjct: 123 gtggagcaacactgtgaggccaagggagtatccgaagaggagaaattctcaggggcagag 182

                                                                       
Query: 148 atggctttgacgggagatgctttcttctggtggtatttctggaaaagaagaaaccagaat 207
           | ||||||||| || || |||||| | ||||||| || ||||| |||| | || ||||| 
Sbjct: 183 aaggctttgactggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaag 242

                         
Query: 208 gcaaaatggtggga 221
           |||| |||||||||
Sbjct: 243 gcaacatggtggga 256