Miyakogusa Predicted Gene

Lj0g3v0225779.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0225779.1 Non Chatacterized Hit- tr|I1MN82|I1MN82_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.56481
PE,63.33,0.000000000000007, ,CUFF.14684.1
         (208 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74144 similar to UniRef100_Q67X97 Cluster: Prolyl car...   357   2e-98

>gnl|LJGI|TC74144 similar to UniRef100_Q67X97 Cluster: Prolyl carboxypeptidase like
           protein; n=1; Arabidopsis thaliana|Rep: Prolyl
           carboxypeptidase like protein - Arabidopsis thaliana
           (Mouse-ear cress), partial (48%)
          Length = 1000

 Score =  357 bits (180), Expect = 2e-98
 Identities = 183/184 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagacagggatggctgatttccacggcggcttcatcgctcttcatctttctatctttc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65  atgagacagggatggctgatttccacggcggcttcatcgctcttcatctttctatctttc 124

                                                                       
Query: 61  gcggcggtctcacacggccttgttccgccgcgcacgctgctcaatcgcttgtctgaaggc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125 gcggcggtctcacacggccttgttccgccgcgcacgctgctcaatcgcttgtctgaaggc 184

                                                                       
Query: 121 agatacctcaacagcaccgagctctggttcaacaatcagaccctcgatcacttctcaccc 180
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 185 agatacctcaacagcaccgagctatggttcaacaatcagaccctcgatcacttctcaccc 244

               
Query: 181 tatg 184
           ||||
Sbjct: 245 tatg 248