Miyakogusa Predicted Gene
- Lj0g3v0225689.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0225689.1 Non Chatacterized Hit- tr|I1LPV6|I1LPV6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,82.22,3e-37,Auxin_inducible,Auxin responsive SAUR protein; FAMILY
NOT NAMED,NULL,CUFF.14679.1
(277 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 119 9e-27
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 103 6e-22
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 68 3e-11
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 66 1e-10
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 58 3e-08
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 58 3e-08
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 119 bits (60), Expect = 9e-27
Identities = 150/180 (83%)
Strand = Plus / Plus
Query: 48 ccaagcatcttcaaaagctgtagacgtgccgaaaggttatcttgccgtttatgtcggaga 107
||||||| |||||||| ||| ||| ||||| || || |||||||| || ||||| |||||
Sbjct: 139 ccaagcagcttcaaaatctgcagaagtgccaaagggatatcttgcagtgtatgttggaga 198
Query: 108 aaaaatgaagaggtttgtgatccccatatcatacttgagggaaacttcattccaagactt 167
|||| |||| ||||||||||||| ||||||||| ||| || ||||||| ||||| ||
Sbjct: 199 taaaacgaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaagagtt 258
Query: 168 gctgattcaagccgaggaacaatttggatatgaccatccaatgggcggtctcacaattcc 227
|| ||||||||| ||| ||||||||||||| |||||||| || ||||||||||||||
Sbjct: 259 actacatcaagccgaagaagaatttggatatgatcatccaataggtggtctcacaattcc 318
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 103 bits (52), Expect = 6e-22
Identities = 151/184 (82%)
Strand = Plus / Minus
Query: 48 ccaagcatcttcaaaagctgtagacgtgccgaaaggttatcttgccgtttatgtcggaga 107
||||||| |||||||| |||| | || |||| || |||||||| || ||||| |||||
Sbjct: 341 ccaagcagcttcaaaatctgttaaagtttcgaagggctatcttgcagtgtatgttggaga 282
Query: 108 aaaaatgaagaggtttgtgatccccatatcatacttgagggaaacttcattccaagactt 167
| || |||||||||||| ||||| |||||||||||| || ||||||| ||||| ||
Sbjct: 281 agaacagaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaatt 222
Query: 168 gctgattcaagccgaggaacaatttggatatgaccatccaatgggcggtctcacaattcc 227
||||| |||||| ||||| | ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 221 gctgagtcaagctgaggacgagtttggatatgatcatcccatgggtggcctcacaattcc 162
Query: 228 ttgc 231
||||
Sbjct: 161 ttgc 158
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 67.9 bits (34), Expect = 3e-11
Identities = 115/142 (80%)
Strand = Plus / Plus
Query: 86 atcttgccgtttatgtcggagaaaaaatgaagaggtttgtgatccccatatcatacttga 145
||||||| || ||||| ||||| |||||| | |||| ||||| || ||||||||||||
Sbjct: 187 atcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagtatcatacttga 246
Query: 146 gggaaacttcattccaagacttgctgattcaagccgaggaacaatttggatatgaccatc 205
|| ||||||| ||||| || || ||||||||| ||| ||||||||||||| ||||
Sbjct: 247 accaaccttcatttcaagagttactatatcaagccgaagaagaatttggatatgatcatc 306
Query: 206 caatgggcggtctcacaattcc 227
||| |||||||||| ||||||
Sbjct: 307 caacaggcggtctcaaaattcc 328
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 65.9 bits (33), Expect = 1e-10
Identities = 114/141 (80%)
Strand = Plus / Plus
Query: 86 atcttgccgtttatgtcggagaaaaaatgaagaggtttgtgatccccatatcatacttga 145
||||||| || ||||| ||||| |||||| | |||||||||| || ||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247
Query: 146 gggaaacttcattccaagacttgctgattcaagccgaggaacaatttggatatgaccatc 205
|| |||| || ||||| || ||| |||||| || ||| ||||||||||||| ||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307
Query: 206 caatgggcggtctcacaattc 226
||| || |||||||||||||
Sbjct: 308 caacaggtggtctcacaattc 328
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 58.0 bits (29), Expect = 3e-08
Identities = 122/153 (79%)
Strand = Plus / Plus
Query: 79 aaaggttatcttgccgtttatgtcggagaaaaaatgaagaggtttgtgatccccatatca 138
||||| |||||||| || ||||| | ||| |||||||| |||||||||||||||| |||
Sbjct: 176 aaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatttca 235
Query: 139 tacttgagggaaacttcattccaagacttgctgattcaagccgaggaacaatttggatat 198
||| ||| || ||||||| ||||| | | | ||||| || ||| ||| ||||||
Sbjct: 236 tacctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacggatat 295
Query: 199 gaccatccaatgggcggtctcacaattccttgc 231
|| |||||| |||| |||||| |||||||||||
Sbjct: 296 gatcatccagtgggtggtctcgcaattccttgc 328
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 58.0 bits (29), Expect = 3e-08
Identities = 138/174 (79%), Gaps = 4/174 (2%)
Strand = Plus / Plus
Query: 58 tcaaaagctgtagacgtgccgaaaggttatcttgccgtttatgtcggagaaaaaatgaag 117
||||||| |||||||||||| || || ||| |||| ||||||| ||| ||| |||||
Sbjct: 451 tcaaaagttgtagacgtgccaaagggatatattgcagtttatg----agagaaactgaag 506
Query: 118 aggtttgtgatccccatatcatacttgagggaaacttcattccaagacttgctgattcaa 177
|| |||||||||||||||||| |||| || | ||| |||| ||| || | ||||
Sbjct: 507 ccgtgtgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaa 566
Query: 178 gccgaggaacaatttggatatgaccatccaatgggcggtctcacaattccttgc 231
|| |||||| | |||||||||||||||| | ||| |||||||| |||||||||
Sbjct: 567 gctgaggaagagtttggatatgaccatcacacgggtggtctcacgattccttgc 620