Miyakogusa Predicted Gene

Lj0g3v0225689.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0225689.1 Non Chatacterized Hit- tr|I1LPV6|I1LPV6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,82.22,3e-37,Auxin_inducible,Auxin responsive SAUR protein; FAMILY
NOT NAMED,NULL,CUFF.14679.1
         (277 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu...   119   9e-27
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind...   103   6e-22
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu...    68   3e-11
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu...    66   1e-10
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind...    58   3e-08
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu...    58   3e-08

>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (80%)
          Length = 528

 Score =  119 bits (60), Expect = 9e-27
 Identities = 150/180 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  ccaagcatcttcaaaagctgtagacgtgccgaaaggttatcttgccgtttatgtcggaga 107
           ||||||| |||||||| ||| ||| ||||| || || |||||||| || ||||| |||||
Sbjct: 139 ccaagcagcttcaaaatctgcagaagtgccaaagggatatcttgcagtgtatgttggaga 198

                                                                       
Query: 108 aaaaatgaagaggtttgtgatccccatatcatacttgagggaaacttcattccaagactt 167
            |||| |||| ||||||||||||| ||||||||| |||   || ||||||| ||||| ||
Sbjct: 199 taaaacgaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaagagtt 258

                                                                       
Query: 168 gctgattcaagccgaggaacaatttggatatgaccatccaatgggcggtctcacaattcc 227
            ||   ||||||||| ||| ||||||||||||| |||||||| || ||||||||||||||
Sbjct: 259 actacatcaagccgaagaagaatttggatatgatcatccaataggtggtctcacaattcc 318


>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
           Glycine max|Rep: Auxin-induced protein 6B - Glycine max
           (Soybean), complete
          Length = 494

 Score =  103 bits (52), Expect = 6e-22
 Identities = 151/184 (82%)
 Strand = Plus / Minus

                                                                       
Query: 48  ccaagcatcttcaaaagctgtagacgtgccgaaaggttatcttgccgtttatgtcggaga 107
           ||||||| |||||||| ||||  | ||  |||| || |||||||| || ||||| |||||
Sbjct: 341 ccaagcagcttcaaaatctgttaaagtttcgaagggctatcttgcagtgtatgttggaga 282

                                                                       
Query: 108 aaaaatgaagaggtttgtgatccccatatcatacttgagggaaacttcattccaagactt 167
           | ||  |||||||||||| |||||  ||||||||||||   || ||||||| ||||| ||
Sbjct: 281 agaacagaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaatt 222

                                                                       
Query: 168 gctgattcaagccgaggaacaatttggatatgaccatccaatgggcggtctcacaattcc 227
           ||||| |||||| |||||  | ||||||||||| ||||| ||||| || |||||||||||
Sbjct: 221 gctgagtcaagctgaggacgagtttggatatgatcatcccatgggtggcctcacaattcc 162

               
Query: 228 ttgc 231
           ||||
Sbjct: 161 ttgc 158


>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (91%)
          Length = 523

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 86  atcttgccgtttatgtcggagaaaaaatgaagaggtttgtgatccccatatcatacttga 145
           ||||||| || ||||| |||||  |||||| | |||| ||||| ||  ||||||||||||
Sbjct: 187 atcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagtatcatacttga 246

                                                                       
Query: 146 gggaaacttcattccaagacttgctgattcaagccgaggaacaatttggatatgaccatc 205
              || ||||||| ||||| || ||   ||||||||| ||| ||||||||||||| ||||
Sbjct: 247 accaaccttcatttcaagagttactatatcaagccgaagaagaatttggatatgatcatc 306

                                 
Query: 206 caatgggcggtctcacaattcc 227
           |||  |||||||||| ||||||
Sbjct: 307 caacaggcggtctcaaaattcc 328


>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
           n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
           Glycine max (Soybean), partial (90%)
          Length = 491

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 114/141 (80%)
 Strand = Plus / Plus

                                                                       
Query: 86  atcttgccgtttatgtcggagaaaaaatgaagaggtttgtgatccccatatcatacttga 145
           ||||||| || ||||| |||||  |||||| | |||||||||| ||  ||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247

                                                                       
Query: 146 gggaaacttcattccaagacttgctgattcaagccgaggaacaatttggatatgaccatc 205
              || |||| || ||||| || |||  |||||| || ||| ||||||||||||| ||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307

                                
Query: 206 caatgggcggtctcacaattc 226
           |||  || |||||||||||||
Sbjct: 308 caacaggtggtctcacaattc 328


>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
           n=1; Glycine max|Rep: Auxin-induced protein 15A -
           Glycine max (Soybean), partial (90%)
          Length = 494

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 122/153 (79%)
 Strand = Plus / Plus

                                                                       
Query: 79  aaaggttatcttgccgtttatgtcggagaaaaaatgaagaggtttgtgatccccatatca 138
           ||||| |||||||| || ||||| | ||| ||||||||  |||||||||||||||| |||
Sbjct: 176 aaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatttca 235

                                                                       
Query: 139 tacttgagggaaacttcattccaagacttgctgattcaagccgaggaacaatttggatat 198
           ||| |||   || ||||||| |||||  |  | |  ||||| || ||| |||  ||||||
Sbjct: 236 tacctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacggatat 295

                                            
Query: 199 gaccatccaatgggcggtctcacaattccttgc 231
           || |||||| |||| |||||| |||||||||||
Sbjct: 296 gatcatccagtgggtggtctcgcaattccttgc 328


>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
           n=1; Glycine max|Rep: Auxin-induced protein X10A -
           Glycine max (Soybean), partial (88%)
          Length = 764

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 138/174 (79%), Gaps = 4/174 (2%)
 Strand = Plus / Plus

                                                                       
Query: 58  tcaaaagctgtagacgtgccgaaaggttatcttgccgtttatgtcggagaaaaaatgaag 117
           ||||||| |||||||||||| || || ||| |||| |||||||    ||| ||| |||||
Sbjct: 451 tcaaaagttgtagacgtgccaaagggatatattgcagtttatg----agagaaactgaag 506

                                                                       
Query: 118 aggtttgtgatccccatatcatacttgagggaaacttcattccaagacttgctgattcaa 177
             || |||||||||||||||||| ||||   || |   ||| |||| ||| || | ||||
Sbjct: 507 ccgtgtgtgatccccatatcatatttgaaccaaccacaatttcaaggcttcctaagtcaa 566

                                                                 
Query: 178 gccgaggaacaatttggatatgaccatccaatgggcggtctcacaattccttgc 231
           || |||||| | ||||||||||||||||  | ||| |||||||| |||||||||
Sbjct: 567 gctgaggaagagtttggatatgaccatcacacgggtggtctcacgattccttgc 620