Miyakogusa Predicted Gene

Lj0g3v0223059.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0223059.1 tr|B3IX34|B3IX34_LOTJA Transcription factor
AP2-EREBP OS=Lotus japonicus GN=LjERF16 PE=2 SV=1,93.7,0,seg,NULL;
DNA-binding domain in plant proteins such as,AP2/ERF domain;
ETHRSPELEMNT,AP2/ERF domain;
,NODE_42815_length_798_cov_61.023811.path1.1
         (714 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75377 similar to UniRef100_A4F249 Cluster: Wound-resp...   434   e-121
gnl|LJGI|AV769213 similar to UniRef100_UPI000039752E Cluster: CO...   315   2e-85
gnl|LJGI|AV413120 homologue to UniRef100_A7Q787 Cluster: Chromos...    78   8e-14
gnl|LJGI|TC76072 similar to UniRef100_A7QT81 Cluster: Chromosome...    62   5e-09
gnl|LJGI|TC76236 homologue to UniRef100_A7QN90 Cluster: Chromoso...    58   8e-08
gnl|LJGI|TC63956 similar to UniRef100_Q9LY29 Cluster: Ethylene-r...    54   1e-06
gnl|LJGI|BW598768 similar to UniRef100_Q75UJ4 Cluster: ERF-like ...    52   5e-06
gnl|LJGI|TC65285 homologue to UniRef100_A7Q787 Cluster: Chromoso...    52   5e-06
gnl|LJGI|TC62436 similar to UniRef100_Q75UJ4 Cluster: ERF-like p...    52   5e-06

>gnl|LJGI|TC75377 similar to UniRef100_A4F249 Cluster: Wound-responsive AP2 like
           factor 2; n=1; Nicotiana tabacum|Rep: Wound-responsive
           AP2 like factor 2 - Nicotiana tabacum (Common tobacco),
           partial (19%)
          Length = 434

 Score =  434 bits (219), Expect = e-121
 Identities = 219/219 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtcaaccctcaccgccgagcaagaattctccgtcatcgtcgccaccctcaccaacgtc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47  atgtcaaccctcaccgccgagcaagaattctccgtcatcgtcgccaccctcaccaacgtc 106

                                                                       
Query: 61  atcgccggctccacctccaccgtcaccgccgcctttccagaccaccaaaccaccaccttt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 atcgccggctccacctccaccgtcaccgccgcctttccagaccaccaaaccaccaccttt 166

                                                                       
Query: 121 gaccggatagtccctccacctgcctccatggaaacttgcaaggaatgcaacattgcagga 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 167 gaccggatagtccctccacctgcctccatggaaacttgcaaggaatgcaacattgcagga 226

                                                  
Query: 181 tgcttgggatgcaaattcttcccggaagaagagagcaat 219
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 227 tgcttgggatgcaaattcttcccggaagaagagagcaat 265



 Score =  176 bits (89), Expect = 1e-43
 Identities = 89/89 (100%)
 Strand = Plus / Plus

                                                                       
Query: 300 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagattcgcgacccgag 359
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 346 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagattcgcgacccgag 405

                                        
Query: 360 gcgcgcggcccgggtctggctggggacgt 388
           |||||||||||||||||||||||||||||
Sbjct: 406 gcgcgcggcccgggtctggctggggacgt 434


>gnl|LJGI|AV769213 similar to UniRef100_UPI000039752E Cluster: COG1172:
           Ribose/xylose/arabinose/galactoside ABC-type transport
           systems, permease components; n=1; Haemophilus somnus
           2336|Rep: COG1172: Ribose/xylose/arabinose/galactoside
           ABC-type transport systems, permease components -
           Haemophilus somnus 2336, partial (5%)
          Length = 393

 Score =  315 bits (159), Expect = 2e-85
 Identities = 159/159 (100%)
 Strand = Plus / Minus

                                                                       
Query: 556 aatgtgatcaaccagggaatggaattggaaggagttgatggtgatcaattttgggatagg 615
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 aatgtgatcaaccagggaatggaattggaaggagttgatggtgatcaattttgggatagg 334

                                                                       
Query: 616 attggggatgcggattttcaacagctgatgatgatgatggatttttctagagattcctct 675
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 attggggatgcggattttcaacagctgatgatgatgatggatttttctagagattcctct 274

                                                  
Query: 676 gactctgttactgggaacactcttagtaacagttcctga 714
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 273 gactctgttactgggaacactcttagtaacagttcctga 235


>gnl|LJGI|AV413120 homologue to UniRef100_A7Q787 Cluster: Chromosome chr18
           scaffold_59, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_59, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (18%)
          Length = 330

 Score = 77.8 bits (39), Expect = 8e-14
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 300 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagattcg 350
           |||||||||||||||||||||||| |||||||||||||| || ||||||||
Sbjct: 213 atacaggggagtgaggcagagaccgtgggggaaatgggcagcggagattcg 263


>gnl|LJGI|TC76072 similar to UniRef100_A7QT81 Cluster: Chromosome chr1 scaffold_166,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_166, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (29%)
          Length = 777

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 310 gtgaggcagagaccttgggggaaatgggctgctga 344
           |||||||||||||||||||| ||||||||||||||
Sbjct: 496 gtgaggcagagaccttggggaaaatgggctgctga 530


>gnl|LJGI|TC76236 homologue to UniRef100_A7QN90 Cluster: Chromosome chr2
           scaffold_132, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr2 scaffold_132, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (25%)
          Length = 744

 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 300 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagatt 348
           ||||||||||||||| ||||| |  ||||||||||||| ||||||||||
Sbjct: 653 atacaggggagtgagacagaggcactgggggaaatgggttgctgagatt 701


>gnl|LJGI|TC63956 similar to UniRef100_Q9LY29 Cluster: Ethylene-responsive
           transcription factor ERF115; n=1; Arabidopsis
           thaliana|Rep: Ethylene-responsive transcription factor
           ERF115 - Arabidopsis thaliana (Mouse-ear cress), partial
           (35%)
          Length = 1114

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 307 ggagtgaggcagagaccttgggggaaatgggctgctgagattcgcga 353
           |||||||||||| | || ||||| ||||||||||| |||||||||||
Sbjct: 389 ggagtgaggcagcggccatggggcaaatgggctgcagagattcgcga 435


>gnl|LJGI|BW598768 similar to UniRef100_Q75UJ4 Cluster: ERF-like protein; n=1; Cucumis
           melo|Rep: ERF-like protein - Cucumis melo (Muskmelon),
           partial (24%)
          Length = 475

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 313 aggcagagaccttgggggaaatgggctgctgagattcg 350
           ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 399 aggcagagaccatggggtaaatgggctgcagagattcg 436


>gnl|LJGI|TC65285 homologue to UniRef100_A7Q787 Cluster: Chromosome chr18
           scaffold_59, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_59, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (12%)
          Length = 811

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 301 tacaggggagtgaggcagagaccttgggggaaatgggc 338
           |||||||||||||||||||| || ||||| ||||||||
Sbjct: 730 tacaggggagtgaggcagaggccatggggaaaatgggc 767


>gnl|LJGI|TC62436 similar to UniRef100_Q75UJ4 Cluster: ERF-like protein; n=1; Cucumis
           melo|Rep: ERF-like protein - Cucumis melo (Muskmelon),
           partial (36%)
          Length = 1164

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 313 aggcagagaccttgggggaaatgggctgctgagattcg 350
           ||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 429 aggcagagaccatggggtaaatgggctgcagagattcg 466