Miyakogusa Predicted Gene
- Lj0g3v0223059.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0223059.1 tr|B3IX34|B3IX34_LOTJA Transcription factor
AP2-EREBP OS=Lotus japonicus GN=LjERF16 PE=2 SV=1,93.7,0,seg,NULL;
DNA-binding domain in plant proteins such as,AP2/ERF domain;
ETHRSPELEMNT,AP2/ERF domain;
,NODE_42815_length_798_cov_61.023811.path1.1
(714 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75377 similar to UniRef100_A4F249 Cluster: Wound-resp... 434 e-121
gnl|LJGI|AV769213 similar to UniRef100_UPI000039752E Cluster: CO... 315 2e-85
gnl|LJGI|AV413120 homologue to UniRef100_A7Q787 Cluster: Chromos... 78 8e-14
gnl|LJGI|TC76072 similar to UniRef100_A7QT81 Cluster: Chromosome... 62 5e-09
gnl|LJGI|TC76236 homologue to UniRef100_A7QN90 Cluster: Chromoso... 58 8e-08
gnl|LJGI|TC63956 similar to UniRef100_Q9LY29 Cluster: Ethylene-r... 54 1e-06
gnl|LJGI|BW598768 similar to UniRef100_Q75UJ4 Cluster: ERF-like ... 52 5e-06
gnl|LJGI|TC65285 homologue to UniRef100_A7Q787 Cluster: Chromoso... 52 5e-06
gnl|LJGI|TC62436 similar to UniRef100_Q75UJ4 Cluster: ERF-like p... 52 5e-06
>gnl|LJGI|TC75377 similar to UniRef100_A4F249 Cluster: Wound-responsive AP2 like
factor 2; n=1; Nicotiana tabacum|Rep: Wound-responsive
AP2 like factor 2 - Nicotiana tabacum (Common tobacco),
partial (19%)
Length = 434
Score = 434 bits (219), Expect = e-121
Identities = 219/219 (100%)
Strand = Plus / Plus
Query: 1 atgtcaaccctcaccgccgagcaagaattctccgtcatcgtcgccaccctcaccaacgtc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47 atgtcaaccctcaccgccgagcaagaattctccgtcatcgtcgccaccctcaccaacgtc 106
Query: 61 atcgccggctccacctccaccgtcaccgccgcctttccagaccaccaaaccaccaccttt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 atcgccggctccacctccaccgtcaccgccgcctttccagaccaccaaaccaccaccttt 166
Query: 121 gaccggatagtccctccacctgcctccatggaaacttgcaaggaatgcaacattgcagga 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 167 gaccggatagtccctccacctgcctccatggaaacttgcaaggaatgcaacattgcagga 226
Query: 181 tgcttgggatgcaaattcttcccggaagaagagagcaat 219
|||||||||||||||||||||||||||||||||||||||
Sbjct: 227 tgcttgggatgcaaattcttcccggaagaagagagcaat 265
Score = 176 bits (89), Expect = 1e-43
Identities = 89/89 (100%)
Strand = Plus / Plus
Query: 300 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagattcgcgacccgag 359
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 346 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagattcgcgacccgag 405
Query: 360 gcgcgcggcccgggtctggctggggacgt 388
|||||||||||||||||||||||||||||
Sbjct: 406 gcgcgcggcccgggtctggctggggacgt 434
>gnl|LJGI|AV769213 similar to UniRef100_UPI000039752E Cluster: COG1172:
Ribose/xylose/arabinose/galactoside ABC-type transport
systems, permease components; n=1; Haemophilus somnus
2336|Rep: COG1172: Ribose/xylose/arabinose/galactoside
ABC-type transport systems, permease components -
Haemophilus somnus 2336, partial (5%)
Length = 393
Score = 315 bits (159), Expect = 2e-85
Identities = 159/159 (100%)
Strand = Plus / Minus
Query: 556 aatgtgatcaaccagggaatggaattggaaggagttgatggtgatcaattttgggatagg 615
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 aatgtgatcaaccagggaatggaattggaaggagttgatggtgatcaattttgggatagg 334
Query: 616 attggggatgcggattttcaacagctgatgatgatgatggatttttctagagattcctct 675
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 attggggatgcggattttcaacagctgatgatgatgatggatttttctagagattcctct 274
Query: 676 gactctgttactgggaacactcttagtaacagttcctga 714
|||||||||||||||||||||||||||||||||||||||
Sbjct: 273 gactctgttactgggaacactcttagtaacagttcctga 235
>gnl|LJGI|AV413120 homologue to UniRef100_A7Q787 Cluster: Chromosome chr18
scaffold_59, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr18 scaffold_59, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (18%)
Length = 330
Score = 77.8 bits (39), Expect = 8e-14
Identities = 48/51 (94%)
Strand = Plus / Plus
Query: 300 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagattcg 350
|||||||||||||||||||||||| |||||||||||||| || ||||||||
Sbjct: 213 atacaggggagtgaggcagagaccgtgggggaaatgggcagcggagattcg 263
>gnl|LJGI|TC76072 similar to UniRef100_A7QT81 Cluster: Chromosome chr1 scaffold_166,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr1 scaffold_166, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (29%)
Length = 777
Score = 61.9 bits (31), Expect = 5e-09
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 310 gtgaggcagagaccttgggggaaatgggctgctga 344
|||||||||||||||||||| ||||||||||||||
Sbjct: 496 gtgaggcagagaccttggggaaaatgggctgctga 530
>gnl|LJGI|TC76236 homologue to UniRef100_A7QN90 Cluster: Chromosome chr2
scaffold_132, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr2 scaffold_132, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (25%)
Length = 744
Score = 58.0 bits (29), Expect = 8e-08
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 300 atacaggggagtgaggcagagaccttgggggaaatgggctgctgagatt 348
||||||||||||||| ||||| | ||||||||||||| ||||||||||
Sbjct: 653 atacaggggagtgagacagaggcactgggggaaatgggttgctgagatt 701
>gnl|LJGI|TC63956 similar to UniRef100_Q9LY29 Cluster: Ethylene-responsive
transcription factor ERF115; n=1; Arabidopsis
thaliana|Rep: Ethylene-responsive transcription factor
ERF115 - Arabidopsis thaliana (Mouse-ear cress), partial
(35%)
Length = 1114
Score = 54.0 bits (27), Expect = 1e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 307 ggagtgaggcagagaccttgggggaaatgggctgctgagattcgcga 353
|||||||||||| | || ||||| ||||||||||| |||||||||||
Sbjct: 389 ggagtgaggcagcggccatggggcaaatgggctgcagagattcgcga 435
>gnl|LJGI|BW598768 similar to UniRef100_Q75UJ4 Cluster: ERF-like protein; n=1; Cucumis
melo|Rep: ERF-like protein - Cucumis melo (Muskmelon),
partial (24%)
Length = 475
Score = 52.0 bits (26), Expect = 5e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 313 aggcagagaccttgggggaaatgggctgctgagattcg 350
||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 399 aggcagagaccatggggtaaatgggctgcagagattcg 436
>gnl|LJGI|TC65285 homologue to UniRef100_A7Q787 Cluster: Chromosome chr18
scaffold_59, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr18 scaffold_59, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (12%)
Length = 811
Score = 52.0 bits (26), Expect = 5e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 301 tacaggggagtgaggcagagaccttgggggaaatgggc 338
|||||||||||||||||||| || ||||| ||||||||
Sbjct: 730 tacaggggagtgaggcagaggccatggggaaaatgggc 767
>gnl|LJGI|TC62436 similar to UniRef100_Q75UJ4 Cluster: ERF-like protein; n=1; Cucumis
melo|Rep: ERF-like protein - Cucumis melo (Muskmelon),
partial (36%)
Length = 1164
Score = 52.0 bits (26), Expect = 5e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 313 aggcagagaccttgggggaaatgggctgctgagattcg 350
||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 429 aggcagagaccatggggtaaatgggctgcagagattcg 466