Miyakogusa Predicted Gene
- Lj0g3v0217689.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0217689.1 CUFF.14061.1
(304 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81136 64 5e-10
gnl|LJGI|TC79347 64 5e-10
>gnl|LJGI|TC81136
Length = 1079
Score = 63.9 bits (32), Expect = 5e-10
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 269 atgaggttaggttgcttctgcagatctggggatgag 304
|||||||| |||||||||||||||||||||||||||
Sbjct: 603 atgaggttgggttgcttctgcagatctggggatgag 638
Score = 58.0 bits (29), Expect = 3e-08
Identities = 39/41 (95%), Gaps = 1/41 (2%)
Strand = Plus / Plus
Query: 4 agggtttgttcagggggtttggatctagaggttgaagtatg 44
|||||||||||||||| ||||||||| ||||||||||||||
Sbjct: 353 agggtttgttcagggg-tttggatctggaggttgaagtatg 392
>gnl|LJGI|TC79347
Length = 518
Score = 63.9 bits (32), Expect = 5e-10
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 269 atgaggttaggttgcttctgcagatctggggatgag 304
|||||||| |||||||||||||||||||||||||||
Sbjct: 105 atgaggttgggttgcttctgcagatctggggatgag 140