Miyakogusa Predicted Gene

Lj0g3v0217689.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0217689.1 CUFF.14061.1
         (304 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81136                                                       64   5e-10
gnl|LJGI|TC79347                                                       64   5e-10

>gnl|LJGI|TC81136 
          Length = 1079

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 269 atgaggttaggttgcttctgcagatctggggatgag 304
           |||||||| |||||||||||||||||||||||||||
Sbjct: 603 atgaggttgggttgcttctgcagatctggggatgag 638



 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 39/41 (95%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                    
Query: 4   agggtttgttcagggggtttggatctagaggttgaagtatg 44
           |||||||||||||||| ||||||||| ||||||||||||||
Sbjct: 353 agggtttgttcagggg-tttggatctggaggttgaagtatg 392


>gnl|LJGI|TC79347 
          Length = 518

 Score = 63.9 bits (32), Expect = 5e-10
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 269 atgaggttaggttgcttctgcagatctggggatgag 304
           |||||||| |||||||||||||||||||||||||||
Sbjct: 105 atgaggttgggttgcttctgcagatctggggatgag 140