Miyakogusa Predicted Gene

Lj0g3v0215489.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0215489.1 Non Chatacterized Hit- tr|I3T190|I3T190_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,41.77,0.00001,coiled-coil,NULL,CUFF.13887.1
         (724 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62714 weakly similar to UniRef100_A1DI68 Cluster: Syb...    52   5e-06

>gnl|LJGI|TC62714 weakly similar to UniRef100_A1DI68 Cluster: Sybindin-like family
            protein; n=1; Neosartorya fischeri NRRL 181|Rep:
            Sybindin-like family protein - Neosartorya fischeri
            (strain ATCC 1020 / DSM 3700 / NRRL 181)(Aspergillus
            fischerianus (strain ATCC 1020 / DSM 3700 / NRRL 181)),
            partial (11%)
          Length = 2143

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                        
Query: 583  aggtcgatgaggttgaaggagatgatagtggagggtgatgtgttggcagaagtgttgatc 642
            |||| ||||||||||||||| ||| | ||| |||  ||||  ||| ||| |||||||| |
Sbjct: 953  aggttgatgaggttgaaggacatgctggtgaaggaagatgaattgtcagcagtgttgacc 1012

                                                      
Query: 643  aactccagactagattccctcaaagagatcatcgaaaacttc 684
            ||||||||||||  ||| ||| |||| |||||| | ||||||
Sbjct: 1013 aactccagactaacttctctccaagaaatcatcaacaacttc 1054