Miyakogusa Predicted Gene

Lj0g3v0214489.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0214489.1 tr|G7JLD8|G7JLD8_MEDTR Subtilisin-like serine
protease OS=Medicago truncatula GN=MTR_4g103490 PE=4
S,66.2,0,SUBTILASE_SER,Peptidase S8, subtilisin, Ser-active site;
Subtilisin-like,Peptidase S8/S53, subtilisi,gene.g16566.t1.1
         (2082 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79460 similar to UniRef100_Q6WNU4 Cluster: Subtilisin...    72   2e-11
gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase...    66   1e-09
gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase ...    64   4e-09
gnl|LJGI|AV420480 similar to UniRef100_A7Q1K2 Cluster: Chromosom...    58   2e-07
gnl|LJGI|TC63919 similar to UniRef100_A2Q1V2 Cluster: Peptidase ...    56   9e-07
gnl|LJGI|TC68158 similar to UniRef100_Q6WNU4 Cluster: Subtilisin...    54   4e-06

>gnl|LJGI|TC79460 similar to UniRef100_Q6WNU4 Cluster: Subtilisin-like protease; n=2;
            Glycine max|Rep: Subtilisin-like protease - Glycine max
            (Soybean), partial (40%)
          Length = 1250

 Score = 71.9 bits (36), Expect = 2e-11
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                            
Query: 1497 ttggagtcctgctgctatcaagtcagcaataatgaccacagcaactac 1544
            ||||||||||||||||||||| |||||||| ||||||||||| |||||
Sbjct: 563  ttggagtcctgctgctatcaaatcagcaattatgaccacagctactac 610


>gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
            subtilisin, kexin, sedolisin; n=1; Medicago
            truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
            sedolisin - Medicago truncatula (Barrel medic), partial
            (26%)
          Length = 729

 Score = 65.9 bits (33), Expect = 1e-09
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1486 cttcatccatattggagtcctgctgctatcaagtcagcaataatgaccacagcaactaca 1545
            ||||||||  ||||||||||  ||||||| || |||||||| ||||||||||||| ||||
Sbjct: 445  cttcatcctaattggagtccatctgctattaaatcagcaatcatgaccacagcaagtaca 504

                     
Query: 1546 aaagataac 1554
            | |||||||
Sbjct: 505  agagataac 513


>gnl|LJGI|TC60447 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
            subtilisin, kexin, sedolisin; n=1; Medicago
            truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
            sedolisin - Medicago truncatula (Barrel medic), partial
            (59%)
          Length = 1964

 Score = 63.9 bits (32), Expect = 4e-09
 Identities = 88/104 (84%), Gaps = 2/104 (1%)
 Strand = Plus / Plus

                                                                        
Query: 1435 acttcaatgtcatgtcctcatgttgctggcattgttgga-ttgttaaaatctcttcatcc 1493
            ||||| ||||| || ||||||||||||||||| | |||| || |||||| | ||||||||
Sbjct: 1784 acttccatgtcttgccctcatgttgctggcatcgctggacttattaaaa-cacttcatcc 1842

                                                        
Query: 1494 atattggagtcctgctgctatcaagtcagcaataatgaccacag 1537
              |||||||||| || |||||||| |||||||| ||||| ||||
Sbjct: 1843 taattggagtccggccgctatcaaatcagcaatcatgacgacag 1886


>gnl|LJGI|AV420480 similar to UniRef100_A7Q1K2 Cluster: Chromosome chr7 scaffold_44,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr7 scaffold_44, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (17%)
          Length = 412

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 1498 tggagtcctgctgctatcaagtcagcaataatgaccacagc 1538
            ||||||||||| |||||||| |||||||||||||| |||||
Sbjct: 267  tggagtcctgccgctatcaaatcagcaataatgacaacagc 307


>gnl|LJGI|TC63919 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
            subtilisin, kexin, sedolisin; n=1; Medicago
            truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
            sedolisin - Medicago truncatula (Barrel medic), partial
            (28%)
          Length = 861

 Score = 56.0 bits (28), Expect = 9e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                    
Query: 1593 ggcaaccccatttgcttatggtgcaggggatattcaacct 1632
            |||||||||||||||||||||| ||||| || ||||||||
Sbjct: 79   ggcaaccccatttgcttatggttcagggcatgttcaacct 118


>gnl|LJGI|TC68158 similar to UniRef100_Q6WNU4 Cluster: Subtilisin-like protease; n=2;
           Glycine max|Rep: Subtilisin-like protease - Glycine max
           (Soybean), partial (51%)
          Length = 1252

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 231 cattattggaaatttagacacaggtgtttggccagaatccaagagtttgagcgatgaag 289
           ||||||||||||  | |||||||| |||||||| ||||||||||| || || |||||||
Sbjct: 469 cattattggaaacctcgacacaggcgtttggcctgaatccaagagctttagtgatgaag 527