Miyakogusa Predicted Gene

Lj0g3v0213389.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0213389.2 tr|D7KV17|D7KV17_ARALL Calmodulin binding protein
OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_,28.93,5e-18,
,CUFF.13725.2
         (786 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|CB826900 similar to UniRef100_A7QP38 Cluster: Chromosom...    78   9e-14

>gnl|LJGI|CB826900 similar to UniRef100_A7QP38 Cluster: Chromosome chr1 scaffold_136,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_136, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (15%)
          Length = 599

 Score = 77.8 bits (39), Expect = 9e-14
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 658 aaacagaaatttacaattagggaagtctccccagaatattgttatgccactgagactaca 717
           |||||||||||| | |||| || ||||||||||||||   ||| |||| |||||||||||
Sbjct: 128 aaacagaaattttctattaaggcagtctccccagaatggggttttgcctctgagactaca 187

                                      
Query: 718 aaggtgatcattattgggtcatttctc 744
           |||||  ||||||||||||| ||||||
Sbjct: 188 aaggtcttcattattgggtcttttctc 214