Miyakogusa Predicted Gene
- Lj0g3v0213149.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0213149.1 tr|Q240I5|Q240I5_TETTS DEAD/DEAH box helicase
family protein OS=Tetrahymena thermophila (strain
SB21,32.39,5.4,seg,NULL,CUFF.13707.1
(219 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74522 410 e-114
gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S riboso... 139 8e-33
gnl|LJGI|FS342567 100 7e-21
>gnl|LJGI|TC74522
Length = 468
Score = 410 bits (207), Expect = e-114
Identities = 216/219 (98%)
Strand = Plus / Plus
Query: 1 atgggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtggcggct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 73 atgggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtggcggct 132
Query: 61 atagcagaagaggagaaaggaggcagatcacgagttccgatccgccgctcctctctcgcg 120
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
Sbjct: 133 atagcagaagaggagaaaggaggcagatcacgagttccgatccgccgctcctttctcggg 192
Query: 121 ccgccacaagctttagatctgaagagaggaggacgatctgaaacccaacttcaccatcct 180
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 193 ccgccacaagctttagatctgaagagaggaggacgatttgaaacccaacttcaccatcct 252
Query: 181 cctcctccattcaacttcatgcgtttgccggtgggttaa 219
|||||||||||||||||||||||||||||||||||||||
Sbjct: 253 cctcctccattcaacttcatgcgtttgccggtgggttaa 291
>gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S ribosomal protein L27a;
n=1; Panax ginseng|Rep: 60S ribosomal protein L27a -
Panax ginseng (Korean ginseng), partial (22%)
Length = 887
Score = 139 bits (70), Expect = 8e-33
Identities = 76/78 (97%)
Strand = Plus / Plus
Query: 77 aaggaggcagatcacgagttccgatccgccgctcctctctcgcgccgccacaagctttag 136
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 276 aaggaggcagatcacgagttccgatccgctgctcctctctcgcgccgccacaagctctag 335
Query: 137 atctgaagagaggaggac 154
||||||||||||||||||
Sbjct: 336 atctgaagagaggaggac 353
Score = 69.9 bits (35), Expect = 6e-12
Identities = 52/57 (91%), Gaps = 3/57 (5%)
Strand = Plus / Minus
Query: 3 gggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtggcggc 59
||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||
Sbjct: 141 gggtgaggaaaggagatggcgtgggttcagggaag---aggagatagtggtggcggc 88
Score = 56.0 bits (28), Expect = 9e-08
Identities = 28/28 (100%)
Strand = Plus / Minus
Query: 51 ggtggcggctatagcagaagaggagaaa 78
||||||||||||||||||||||||||||
Sbjct: 61 ggtggcggctatagcagaagaggagaaa 34
>gnl|LJGI|FS342567
Length = 591
Score = 99.6 bits (50), Expect = 7e-21
Identities = 53/54 (98%)
Strand = Plus / Minus
Query: 2 tgggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtgg 55
|||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 366 tgggtgaggaaaggagatggcgcgagttcagggaagagaaggagatggtggtgg 313
Score = 69.9 bits (35), Expect = 6e-12
Identities = 41/43 (95%)
Strand = Plus / Plus
Query: 77 aaggaggcagatcacgagttccgatccgccgctcctctctcgc 119
||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 528 aaggaggcagatcacgagttccgatccgctgcgcctctctcgc 570