Miyakogusa Predicted Gene

Lj0g3v0213149.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0213149.1 tr|Q240I5|Q240I5_TETTS DEAD/DEAH box helicase
family protein OS=Tetrahymena thermophila (strain
SB21,32.39,5.4,seg,NULL,CUFF.13707.1
         (219 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74522                                                      410   e-114
gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S riboso...   139   8e-33
gnl|LJGI|FS342567                                                     100   7e-21

>gnl|LJGI|TC74522 
          Length = 468

 Score =  410 bits (207), Expect = e-114
 Identities = 216/219 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtggcggct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 73  atgggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtggcggct 132

                                                                       
Query: 61  atagcagaagaggagaaaggaggcagatcacgagttccgatccgccgctcctctctcgcg 120
           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
Sbjct: 133 atagcagaagaggagaaaggaggcagatcacgagttccgatccgccgctcctttctcggg 192

                                                                       
Query: 121 ccgccacaagctttagatctgaagagaggaggacgatctgaaacccaacttcaccatcct 180
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 193 ccgccacaagctttagatctgaagagaggaggacgatttgaaacccaacttcaccatcct 252

                                                  
Query: 181 cctcctccattcaacttcatgcgtttgccggtgggttaa 219
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 253 cctcctccattcaacttcatgcgtttgccggtgggttaa 291


>gnl|LJGI|TC72620 similar to UniRef100_Q9MAW6 Cluster: 60S ribosomal protein L27a;
           n=1; Panax ginseng|Rep: 60S ribosomal protein L27a -
           Panax ginseng (Korean ginseng), partial (22%)
          Length = 887

 Score =  139 bits (70), Expect = 8e-33
 Identities = 76/78 (97%)
 Strand = Plus / Plus

                                                                       
Query: 77  aaggaggcagatcacgagttccgatccgccgctcctctctcgcgccgccacaagctttag 136
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 276 aaggaggcagatcacgagttccgatccgctgctcctctctcgcgccgccacaagctctag 335

                             
Query: 137 atctgaagagaggaggac 154
           ||||||||||||||||||
Sbjct: 336 atctgaagagaggaggac 353



 Score = 69.9 bits (35), Expect = 6e-12
 Identities = 52/57 (91%), Gaps = 3/57 (5%)
 Strand = Plus / Minus

                                                                    
Query: 3   gggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtggcggc 59
           ||||||||||||||||||||| |||||||||||||   ||||||| |||||||||||
Sbjct: 141 gggtgaggaaaggagatggcgtgggttcagggaag---aggagatagtggtggcggc 88



 Score = 56.0 bits (28), Expect = 9e-08
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                      
Query: 51 ggtggcggctatagcagaagaggagaaa 78
          ||||||||||||||||||||||||||||
Sbjct: 61 ggtggcggctatagcagaagaggagaaa 34


>gnl|LJGI|FS342567 
          Length = 591

 Score = 99.6 bits (50), Expect = 7e-21
 Identities = 53/54 (98%)
 Strand = Plus / Minus

                                                                 
Query: 2   tgggtgaggaaaggagatggcgcgggttcagggaagagaaggagatggtggtgg 55
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 366 tgggtgaggaaaggagatggcgcgagttcagggaagagaaggagatggtggtgg 313



 Score = 69.9 bits (35), Expect = 6e-12
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                      
Query: 77  aaggaggcagatcacgagttccgatccgccgctcctctctcgc 119
           ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 528 aaggaggcagatcacgagttccgatccgctgcgcctctctcgc 570