Miyakogusa Predicted Gene
- Lj0g3v0212469.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0212469.1 Non Chatacterized Hit- tr|I1K1S1|I1K1S1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.15507
PE,84.72,0,CSAPPISMRASE,Cyclophilin-like peptidyl-prolyl cis-trans
isomerase domain; TPR,Tetratricopeptide repe,CUFF.13668.1
(1083 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW597367 similar to UniRef100_Q9C566 Cluster: Peptidyl-... 890 0.0
gnl|LJGI|TC58586 similar to UniRef100_A7P9E4 Cluster: Peptidyl-p... 80 3e-14
gnl|LJGI|TC72204 homologue to UniRef100_Q8W435 Cluster: Peptidyl... 70 3e-11
gnl|LJGI|AV408266 similar to UniRef100_A1ECK2 Cluster: Peptidyl-... 68 1e-10
gnl|LJGI|AI967483 homologue to UniRef100_A1ECK2 Cluster: Peptidy... 66 5e-10
gnl|LJGI|TC77669 homologue to UniRef100_Q8W435 Cluster: Peptidyl... 66 5e-10
gnl|LJGI|TC63275 homologue to UniRef100_Q8W435 Cluster: Peptidyl... 66 5e-10
gnl|LJGI|TC72558 similar to UniRef100_A7P9E4 Cluster: Peptidyl-p... 64 2e-09
gnl|LJGI|TC73045 similar to UniRef100_A5AKD8 Cluster: Peptidyl-p... 58 1e-07
>gnl|LJGI|BW597367 similar to UniRef100_Q9C566 Cluster: Peptidyl-prolyl cis-trans
isomerase CYP40; n=2; Arabidopsis thaliana|Rep:
Peptidyl-prolyl cis-trans isomerase CYP40 - Arabidopsis
thaliana (Mouse-ear cress), partial (40%)
Length = 472
Score = 890 bits (449), Expect = 0.0
Identities = 449/449 (100%)
Strand = Plus / Plus
Query: 1 atggcgaaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24 atggcgaaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatc 83
Query: 61 gtcatcgaactcttcaacgacgtcgttcccaaaaccgccgagaatttccgcgctctctgc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 84 gtcatcgaactcttcaacgacgtcgttcccaaaaccgccgagaatttccgcgctctctgc 143
Query: 121 actggcgaaaagggcatcggtccccacaccggcgttcccctccactacaagggtatgcgt 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 144 actggcgaaaagggcatcggtccccacaccggcgttcccctccactacaagggtatgcgt 203
Query: 181 ttccaccgcgtgattaaaggcttcatgatccaaggtggggatatctctgccggtgacgga 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 204 ttccaccgcgtgattaaaggcttcatgatccaaggtggggatatctctgccggtgacgga 263
Query: 241 accggcggggaatcgatttacggtttgaaattcgaggatgagggttttgagctgaagcat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 accggcggggaatcgatttacggtttgaaattcgaggatgagggttttgagctgaagcat 323
Query: 301 gagaggaaagggatgttgtccatggcgaattcgggcccggacactaatggctcccagttt 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 gagaggaaagggatgttgtccatggcgaattcgggcccggacactaatggctcccagttt 383
Query: 361 tttatcactaccactcggacccctcacttggatgggaagcatgtggtgtttgggaaggtt 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 tttatcactaccactcggacccctcacttggatgggaagcatgtggtgtttgggaaggtt 443
Query: 421 cttaaggggatgggggtggttcgttctgt 449
|||||||||||||||||||||||||||||
Sbjct: 444 cttaaggggatgggggtggttcgttctgt 472
>gnl|LJGI|TC58586 similar to UniRef100_A7P9E4 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
cis-trans isomerase - Vitis vinifera (Grape), complete
Length = 1348
Score = 79.8 bits (40), Expect = 3e-14
Identities = 138/170 (81%), Gaps = 3/170 (1%)
Strand = Plus / Plus
Query: 799 tttaccaacagttctgcttgtaaattgaaattaggcgatctacaaggagctgtactagat 858
||||| ||||| ||||||||||| |||||||| || ||||| ||||||| || | |||
Sbjct: 823 tttacaaacagctctgcttgtaagttgaaattgggagatcttaaaggagcattattggat 882
Query: 859 gcagactttgcattgcatgagggagataa---tgcaaaagctttgttccgcaaaggccag 915
|||| |||||| | | ||| ||||| || ||| |||||||||||||| |||| |||
Sbjct: 883 acagaatttgcaatccgtgacggagacaacaatgccaaagctttgttccggcaagggcag 942
Query: 916 gcatatatggcactcaatgacatagatggtgctgttgaaagcttcaagaa 965
|||| ||||||||| ||||||| |||| ||| ||||||||||| |||||
Sbjct: 943 acatacatggcactccatgacattgatgctgcagttgaaagctttaagaa 992
Score = 54.0 bits (27), Expect = 2e-06
Identities = 177/227 (77%)
Strand = Plus / Plus
Query: 100 gagaatttccgcgctctctgcactggcgaaaagggcatcggtccccacaccggcgttccc 159
||||||||| | |||||||||||||| ||||| ||||| ||||| |||| || || ||
Sbjct: 127 gagaatttcagagctctctgcactggagaaaaaggcattggtccaaacactggtgtgcct 186
Query: 160 ctccactacaagggtatgcgtttccaccgcgtgattaaaggcttcatgatccaaggtggg 219
||||| | |||||| | || || || || ||||||||||| ||||||||||| ||
Sbjct: 187 ctccatttcaagggatcttgctttcatcgtgttattaaaggctttatgatccaaggaggc 246
Query: 220 gatatctctgccggtgacggaaccggcggggaatcgatttacggtttgaaattcgaggat 279
||||| ||||| || || || || || || ||||| || || || | || || || |||
Sbjct: 247 gatatatctgctggagatggtacaggaggagaatctatatatggacttaagtttgaagat 306
Query: 280 gagggttttgagctgaagcatgagaggaaagggatgttgtccatggc 326
|| ||||||| |||||||||| |||||||||||||| || |||||
Sbjct: 307 gaaaattttgagatgaagcatgaaaggaaagggatgttatcaatggc 353
>gnl|LJGI|TC72204 homologue to UniRef100_Q8W435 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Vigna radiata|Rep: Peptidyl-prolyl
cis-trans isomerase - Vigna radiata, complete
Length = 614
Score = 69.9 bits (35), Expect = 3e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 7 aaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatcgtcat 65
||||||||||||||||||||||| | |||||||||| ||| || ||||||||||||||
Sbjct: 89 aaccctaaggtcttcttcgacatgaccatcggcggccaacccgccggccgcatcgtcat 147
>gnl|LJGI|AV408266 similar to UniRef100_A1ECK2 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Citrus cv. Shiranuhi|Rep:
Peptidyl-prolyl cis-trans isomerase - Citrus cv.
Shiranuhi, partial (82%)
Length = 431
Score = 67.9 bits (34), Expect = 1e-10
Identities = 109/134 (81%)
Strand = Plus / Plus
Query: 1 atggcgaaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatc 60
||||| ||||||||||| ||||||||||| | |||||| ||| ||| || |||||||||
Sbjct: 9 atggcaaaccctaaggttttcttcgacatgaccatcggtggccaacccgccggccgcatc 68
Query: 61 gtcatcgaactcttcaacgacgtcgttcccaaaaccgccgagaatttccgcgctctctgc 120
||||| || || ||| || || ||| |||||||||||||||||||||||||||
Sbjct: 69 gtcatggagcttttcgctgatgtgaccccccgcaccgccgagaatttccgcgctctctgc 128
Query: 121 actggcgaaaaggg 134
|| ||||| |||||
Sbjct: 129 accggcgagaaggg 142
>gnl|LJGI|AI967483 homologue to UniRef100_A1ECK2 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Citrus cv. Shiranuhi|Rep:
Peptidyl-prolyl cis-trans isomerase - Citrus cv.
Shiranuhi, partial (75%)
Length = 491
Score = 65.9 bits (33), Expect = 5e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 94 accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 112 accgccgagaatttccgcgctctctgcaccggcgagaaggg 152
>gnl|LJGI|TC77669 homologue to UniRef100_Q8W435 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Vigna radiata|Rep: Peptidyl-prolyl
cis-trans isomerase - Vigna radiata, partial (77%)
Length = 760
Score = 65.9 bits (33), Expect = 5e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 94 accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 38 accgccgagaatttccgcgctctctgcaccggcgagaaggg 78
>gnl|LJGI|TC63275 homologue to UniRef100_Q8W435 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Vigna radiata|Rep: Peptidyl-prolyl
cis-trans isomerase - Vigna radiata, complete
Length = 813
Score = 65.9 bits (33), Expect = 5e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 94 accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 141 accgccgagaatttccgcgctctctgcaccggcgagaaggg 181
>gnl|LJGI|TC72558 similar to UniRef100_A7P9E4 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
cis-trans isomerase - Vitis vinifera (Grape), partial
(57%)
Length = 687
Score = 63.9 bits (32), Expect = 2e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 546 taacttttttaaggatggtgatagttatcctgattggccggcggatcttgatgaga 601
||||||||| || |||||||||| ||||||||||||||| || || ||||||||||
Sbjct: 608 taactttttcaaagatggtgatacttatcctgattggccagcagaccttgatgaga 663
Score = 54.0 bits (27), Expect = 2e-06
Identities = 177/227 (77%)
Strand = Plus / Plus
Query: 100 gagaatttccgcgctctctgcactggcgaaaagggcatcggtccccacaccggcgttccc 159
||||||||| | |||||||||||||| ||||| ||||| ||||| |||| || || ||
Sbjct: 165 gagaatttcagagctctctgcactggagaaaaaggcattggtccaaacactggtgtgcct 224
Query: 160 ctccactacaagggtatgcgtttccaccgcgtgattaaaggcttcatgatccaaggtggg 219
||||| | |||||| | || || || || ||||||||||| ||||||||||| ||
Sbjct: 225 ctccatttcaagggatcttgctttcatcgtgttattaaaggctttatgatccaaggaggc 284
Query: 220 gatatctctgccggtgacggaaccggcggggaatcgatttacggtttgaaattcgaggat 279
||||| ||||| || || || || || || ||||| || || || | || || || |||
Sbjct: 285 gatatatctgctggagatggtacaggaggagaatctatatatggacttaagtttgaagat 344
Query: 280 gagggttttgagctgaagcatgagaggaaagggatgttgtccatggc 326
|| ||||||| |||||||||| |||||||||||||| || |||||
Sbjct: 345 gaaaattttgagatgaagcatgaaaggaaagggatgttatcaatggc 391
>gnl|LJGI|TC73045 similar to UniRef100_A5AKD8 Cluster: Peptidyl-prolyl cis-trans
isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
cis-trans isomerase - Vitis vinifera (Grape), partial
(83%)
Length = 492
Score = 58.0 bits (29), Expect = 1e-07
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 94 accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
|||||||||||||||||||| |||||||| ||||| |||||
Sbjct: 157 accgccgagaatttccgcgccctctgcaccggcgagaaggg 197
Score = 54.0 bits (27), Expect = 2e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 389 tggatgggaagcatgtggtgtttgggaaggt 419
|||||||||||||||||||||| ||||||||
Sbjct: 449 tggatgggaagcatgtggtgttcgggaaggt 479