Miyakogusa Predicted Gene

Lj0g3v0212469.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0212469.1 Non Chatacterized Hit- tr|I1K1S1|I1K1S1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.15507
PE,84.72,0,CSAPPISMRASE,Cyclophilin-like peptidyl-prolyl cis-trans
isomerase domain; TPR,Tetratricopeptide repe,CUFF.13668.1
         (1083 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW597367 similar to UniRef100_Q9C566 Cluster: Peptidyl-...   890   0.0  
gnl|LJGI|TC58586 similar to UniRef100_A7P9E4 Cluster: Peptidyl-p...    80   3e-14
gnl|LJGI|TC72204 homologue to UniRef100_Q8W435 Cluster: Peptidyl...    70   3e-11
gnl|LJGI|AV408266 similar to UniRef100_A1ECK2 Cluster: Peptidyl-...    68   1e-10
gnl|LJGI|AI967483 homologue to UniRef100_A1ECK2 Cluster: Peptidy...    66   5e-10
gnl|LJGI|TC77669 homologue to UniRef100_Q8W435 Cluster: Peptidyl...    66   5e-10
gnl|LJGI|TC63275 homologue to UniRef100_Q8W435 Cluster: Peptidyl...    66   5e-10
gnl|LJGI|TC72558 similar to UniRef100_A7P9E4 Cluster: Peptidyl-p...    64   2e-09
gnl|LJGI|TC73045 similar to UniRef100_A5AKD8 Cluster: Peptidyl-p...    58   1e-07

>gnl|LJGI|BW597367 similar to UniRef100_Q9C566 Cluster: Peptidyl-prolyl cis-trans
           isomerase CYP40; n=2; Arabidopsis thaliana|Rep:
           Peptidyl-prolyl cis-trans isomerase CYP40 - Arabidopsis
           thaliana (Mouse-ear cress), partial (40%)
          Length = 472

 Score =  890 bits (449), Expect = 0.0
 Identities = 449/449 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcgaaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24  atggcgaaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatc 83

                                                                       
Query: 61  gtcatcgaactcttcaacgacgtcgttcccaaaaccgccgagaatttccgcgctctctgc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 84  gtcatcgaactcttcaacgacgtcgttcccaaaaccgccgagaatttccgcgctctctgc 143

                                                                       
Query: 121 actggcgaaaagggcatcggtccccacaccggcgttcccctccactacaagggtatgcgt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 144 actggcgaaaagggcatcggtccccacaccggcgttcccctccactacaagggtatgcgt 203

                                                                       
Query: 181 ttccaccgcgtgattaaaggcttcatgatccaaggtggggatatctctgccggtgacgga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 204 ttccaccgcgtgattaaaggcttcatgatccaaggtggggatatctctgccggtgacgga 263

                                                                       
Query: 241 accggcggggaatcgatttacggtttgaaattcgaggatgagggttttgagctgaagcat 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 accggcggggaatcgatttacggtttgaaattcgaggatgagggttttgagctgaagcat 323

                                                                       
Query: 301 gagaggaaagggatgttgtccatggcgaattcgggcccggacactaatggctcccagttt 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 gagaggaaagggatgttgtccatggcgaattcgggcccggacactaatggctcccagttt 383

                                                                       
Query: 361 tttatcactaccactcggacccctcacttggatgggaagcatgtggtgtttgggaaggtt 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 tttatcactaccactcggacccctcacttggatgggaagcatgtggtgtttgggaaggtt 443

                                        
Query: 421 cttaaggggatgggggtggttcgttctgt 449
           |||||||||||||||||||||||||||||
Sbjct: 444 cttaaggggatgggggtggttcgttctgt 472


>gnl|LJGI|TC58586 similar to UniRef100_A7P9E4 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vitis vinifera (Grape), complete
          Length = 1348

 Score = 79.8 bits (40), Expect = 3e-14
 Identities = 138/170 (81%), Gaps = 3/170 (1%)
 Strand = Plus / Plus

                                                                       
Query: 799 tttaccaacagttctgcttgtaaattgaaattaggcgatctacaaggagctgtactagat 858
           ||||| ||||| ||||||||||| |||||||| || |||||  |||||||  || | |||
Sbjct: 823 tttacaaacagctctgcttgtaagttgaaattgggagatcttaaaggagcattattggat 882

                                                                       
Query: 859 gcagactttgcattgcatgagggagataa---tgcaaaagctttgttccgcaaaggccag 915
            |||| |||||| | | ||| ||||| ||   ||| ||||||||||||||  |||| |||
Sbjct: 883 acagaatttgcaatccgtgacggagacaacaatgccaaagctttgttccggcaagggcag 942

                                                             
Query: 916 gcatatatggcactcaatgacatagatggtgctgttgaaagcttcaagaa 965
            |||| ||||||||| ||||||| |||| ||| ||||||||||| |||||
Sbjct: 943 acatacatggcactccatgacattgatgctgcagttgaaagctttaagaa 992



 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 177/227 (77%)
 Strand = Plus / Plus

                                                                       
Query: 100 gagaatttccgcgctctctgcactggcgaaaagggcatcggtccccacaccggcgttccc 159
           ||||||||| | |||||||||||||| ||||| ||||| |||||  |||| || || || 
Sbjct: 127 gagaatttcagagctctctgcactggagaaaaaggcattggtccaaacactggtgtgcct 186

                                                                       
Query: 160 ctccactacaagggtatgcgtttccaccgcgtgattaaaggcttcatgatccaaggtggg 219
           ||||| | ||||||     | || || || || ||||||||||| ||||||||||| || 
Sbjct: 187 ctccatttcaagggatcttgctttcatcgtgttattaaaggctttatgatccaaggaggc 246

                                                                       
Query: 220 gatatctctgccggtgacggaaccggcggggaatcgatttacggtttgaaattcgaggat 279
           ||||| ||||| || || || || || || ||||| || || ||  | || || || |||
Sbjct: 247 gatatatctgctggagatggtacaggaggagaatctatatatggacttaagtttgaagat 306

                                                          
Query: 280 gagggttttgagctgaagcatgagaggaaagggatgttgtccatggc 326
           ||   ||||||| |||||||||| |||||||||||||| || |||||
Sbjct: 307 gaaaattttgagatgaagcatgaaaggaaagggatgttatcaatggc 353


>gnl|LJGI|TC72204 homologue to UniRef100_Q8W435 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vigna radiata|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vigna radiata, complete
          Length = 614

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 7   aaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatcgtcat 65
           ||||||||||||||||||||||| | |||||||||| ||| ||  ||||||||||||||
Sbjct: 89  aaccctaaggtcttcttcgacatgaccatcggcggccaacccgccggccgcatcgtcat 147


>gnl|LJGI|AV408266 similar to UniRef100_A1ECK2 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Citrus cv. Shiranuhi|Rep:
           Peptidyl-prolyl cis-trans isomerase - Citrus cv.
           Shiranuhi, partial (82%)
          Length = 431

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcgaaccctaaggtcttcttcgacatcagcatcggcggcgaactcgaaggccgcatc 60
           ||||| ||||||||||| ||||||||||| | |||||| ||| ||| ||  |||||||||
Sbjct: 9   atggcaaaccctaaggttttcttcgacatgaccatcggtggccaacccgccggccgcatc 68

                                                                       
Query: 61  gtcatcgaactcttcaacgacgtcgttcccaaaaccgccgagaatttccgcgctctctgc 120
           ||||| || || |||   || ||    |||   |||||||||||||||||||||||||||
Sbjct: 69  gtcatggagcttttcgctgatgtgaccccccgcaccgccgagaatttccgcgctctctgc 128

                         
Query: 121 actggcgaaaaggg 134
           || ||||| |||||
Sbjct: 129 accggcgagaaggg 142


>gnl|LJGI|AI967483 homologue to UniRef100_A1ECK2 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Citrus cv. Shiranuhi|Rep:
           Peptidyl-prolyl cis-trans isomerase - Citrus cv.
           Shiranuhi, partial (75%)
          Length = 491

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 94  accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
           ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 112 accgccgagaatttccgcgctctctgcaccggcgagaaggg 152


>gnl|LJGI|TC77669 homologue to UniRef100_Q8W435 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vigna radiata|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vigna radiata, partial (77%)
          Length = 760

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 94  accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
           ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 38  accgccgagaatttccgcgctctctgcaccggcgagaaggg 78


>gnl|LJGI|TC63275 homologue to UniRef100_Q8W435 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vigna radiata|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vigna radiata, complete
          Length = 813

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 94  accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
           ||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 141 accgccgagaatttccgcgctctctgcaccggcgagaaggg 181


>gnl|LJGI|TC72558 similar to UniRef100_A7P9E4 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vitis vinifera (Grape), partial
           (57%)
          Length = 687

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 546 taacttttttaaggatggtgatagttatcctgattggccggcggatcttgatgaga 601
           ||||||||| || |||||||||| ||||||||||||||| || || ||||||||||
Sbjct: 608 taactttttcaaagatggtgatacttatcctgattggccagcagaccttgatgaga 663



 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 177/227 (77%)
 Strand = Plus / Plus

                                                                       
Query: 100 gagaatttccgcgctctctgcactggcgaaaagggcatcggtccccacaccggcgttccc 159
           ||||||||| | |||||||||||||| ||||| ||||| |||||  |||| || || || 
Sbjct: 165 gagaatttcagagctctctgcactggagaaaaaggcattggtccaaacactggtgtgcct 224

                                                                       
Query: 160 ctccactacaagggtatgcgtttccaccgcgtgattaaaggcttcatgatccaaggtggg 219
           ||||| | ||||||     | || || || || ||||||||||| ||||||||||| || 
Sbjct: 225 ctccatttcaagggatcttgctttcatcgtgttattaaaggctttatgatccaaggaggc 284

                                                                       
Query: 220 gatatctctgccggtgacggaaccggcggggaatcgatttacggtttgaaattcgaggat 279
           ||||| ||||| || || || || || || ||||| || || ||  | || || || |||
Sbjct: 285 gatatatctgctggagatggtacaggaggagaatctatatatggacttaagtttgaagat 344

                                                          
Query: 280 gagggttttgagctgaagcatgagaggaaagggatgttgtccatggc 326
           ||   ||||||| |||||||||| |||||||||||||| || |||||
Sbjct: 345 gaaaattttgagatgaagcatgaaaggaaagggatgttatcaatggc 391


>gnl|LJGI|TC73045 similar to UniRef100_A5AKD8 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vitis vinifera (Grape), partial
           (83%)
          Length = 492

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 94  accgccgagaatttccgcgctctctgcactggcgaaaaggg 134
           |||||||||||||||||||| |||||||| ||||| |||||
Sbjct: 157 accgccgagaatttccgcgccctctgcaccggcgagaaggg 197



 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 389 tggatgggaagcatgtggtgtttgggaaggt 419
           |||||||||||||||||||||| ||||||||
Sbjct: 449 tggatgggaagcatgtggtgttcgggaaggt 479