Miyakogusa Predicted Gene

Lj0g3v0211999.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0211999.1 Non Chatacterized Hit- tr|I1JKW6|I1JKW6_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,62.79,2e-19,no
description,NULL,NODE_90043_length_251_cov_26.139442.path2.1
         (256 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP066885 weakly similar to UniRef100_A2Q526 Cluster: Le...    96   1e-19
gnl|LJGI|TC80664 weakly similar to UniRef100_Q2YE88 Cluster: NBS...    80   7e-15

>gnl|LJGI|BP066885 weakly similar to UniRef100_A2Q526 Cluster: Leucine Rich Repeat
           family protein; n=1; Medicago truncatula|Rep: Leucine
           Rich Repeat family protein - Medicago truncatula (Barrel
           medic), partial (12%)
          Length = 469

 Score = 95.6 bits (48), Expect = 1e-19
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 60  ttgttcatctgtcagatcattcccgggagattgtttacctgcatcactgaagaacttgcg 119
           ||||||||||| |  |||||||||||||||||||||||| |||||||| |||| ||||  
Sbjct: 359 ttgttcatctgccttatcattcccgggagattgtttacccgcatcactcaagagcttgta 300

                                               
Query: 120 tatcaaggatttcaggaagctagaatttccaaagca 155
           ||||  |||||||||| | |||||||||||||||||
Sbjct: 299 tatccgggatttcagggaactagaatttccaaagca 264


>gnl|LJGI|TC80664 weakly similar to UniRef100_Q2YE88 Cluster: NBS-LRR type disease
           resistance protein Rps1-k-1; n=1; Glycine max|Rep:
           NBS-LRR type disease resistance protein Rps1-k-1 -
           Glycine max (Soybean), partial (21%)
          Length = 1338

 Score = 79.8 bits (40), Expect = 7e-15
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 193 agctgtgattctctcacatccctcctgttggagagctttccaaatctccattctctcacg 252
           |||||||||||||||| |||||| | |||||||| |||||||||||||| ||||||||| 
Sbjct: 617 agctgtgattctctcatatcccttcagttggagacctttccaaatctccgttctctcacc 676

               
Query: 253 atca 256
           ||||
Sbjct: 677 atca 680