Miyakogusa Predicted Gene

Lj0g3v0211729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0211729.1 Non Chatacterized Hit- tr|G7JTY2|G7JTY2_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,66.74,0,seg,NULL,CUFF.13630.1
         (2778 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO035776 similar to UniRef100_A2Q504 Cluster: DDT; Home...    64   5e-09

>gnl|LJGI|GO035776 similar to UniRef100_A2Q504 Cluster: DDT; Homeodomain-related; n=1;
           Medicago truncatula|Rep: DDT; Homeodomain-related -
           Medicago truncatula (Barrel medic), partial (7%)
          Length = 505

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 928 cgtaatcgatactggcagttcattacatctgcttctcgtaatgatcctggctgtggcagg 987
           ||||||||||| ||||| ||  || ||||||||||| | ||||||||||||| |||||||
Sbjct: 160 cgtaatcgatattggcaatttgttgcatctgcttcttgcaatgatcctggctctggcagg 101

                   
Query: 988 atttttgt 995
           || |||||
Sbjct: 100 atatttgt 93