Miyakogusa Predicted Gene

Lj0g3v0209969.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0209969.2 Non Chatacterized Hit- tr|I1JLP3|I1JLP3_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75.09,0,Chromo
domain-like,Chromo domain-like; Ribonuclease H-like,Ribonuclease
H-like domain; Chromo,Chromo,CUFF.13498.2
         (855 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Po...    58   9e-08

>gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Polyprotein; n=1;
           Glycine max|Rep: Polyprotein - Glycine max (Soybean),
           partial (4%)
          Length = 560

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 733 gctttccctcaatttccccttgaggacaaggtggctctttt 773
           ||||| |||||||||||||||||||||||||| | ||||||
Sbjct: 327 gcttttcctcaatttccccttgaggacaaggtcgttctttt 367