Miyakogusa Predicted Gene
- Lj0g3v0209969.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0209969.1 Non Chatacterized Hit- tr|I1JLP3|I1JLP3_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75.09,0,Chromo
domain-like,Chromo domain-like; Ribonuclease H-like,Ribonuclease
H-like domain; Chromo,Chromo,CUFF.13498.1
(855 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Po... 58 9e-08
>gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Polyprotein; n=1;
Glycine max|Rep: Polyprotein - Glycine max (Soybean),
partial (4%)
Length = 560
Score = 58.0 bits (29), Expect = 9e-08
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 733 gctttccctcaatttccccttgaggacaaggtggctctttt 773
||||| |||||||||||||||||||||||||| | ||||||
Sbjct: 327 gcttttcctcaatttccccttgaggacaaggtcgttctttt 367