Miyakogusa Predicted Gene

Lj0g3v0205729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0205729.1 Non Chatacterized Hit- tr|I1JVD3|I1JVD3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.5349
PE=,76.15,0,Leucine-rich repeats, typical (most populate,Leucine-rich
repeat, typical subtype; Leucine-rich repe,CUFF.13159.1
         (1998 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72911 similar to UniRef100_UPI0000660C9E Cluster: Vas...   420   e-116

>gnl|LJGI|TC72911 similar to UniRef100_UPI0000660C9E Cluster: Vasopressin V2 receptor
           (Renal-type arginine vasopressin receptor) (Antidiuretic
           hormone receptor) (AVPR V2).; n=1; Takifugu
           rubripes|Rep: Vasopressin V2 receptor (Renal-type
           arginine vasopressin receptor) (Antidiuretic hormone
           receptor) (AVPR V2). - Takifugu rubripes, partial (5%)
          Length = 727

 Score =  420 bits (212), Expect = e-116
 Identities = 233/236 (98%), Gaps = 3/236 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggccatgtgtaggtgtgtgtctgttttgactggatggaaggagaagaacaagggcagc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 atggccatgtgtaggtgtgtgtctgttttgactggatggaaggagaagaacaagggcagc 554

                                                                       
Query: 61  agcaaacgatattcaaaaggggaccttcacgctccacttgtaaaagaacagcagccgagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 555 agcaaacgatattcaaaaggggaccttcacgctccacttgtaaaagaacagcagccgagg 614

                                                                       
Query: 121 atgagtcgtgatttgaagccagccacccttgatgttatagtctcctgtggtgtccagaag 180
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 615 atgagtcgtgatttgaagccag-cacccttgatgttatagtctcctgtggtgtccagaag 673

                                                                   
Query: 181 aattcgaagtacaatgagaagattatgaatcttgagagtcctgtgaagactgaagc 236
           |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 674 aattcgaagtacaatgag-agattatgaatcttgagagtcctgtg-agactgaagc 727