Miyakogusa Predicted Gene

Lj0g3v0205139.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0205139.1 Non Chatacterized Hit- tr|D6BRE2|D6BRE2_9ROSI
Putative uncharacterized protein OS=Jatropha curcas
PE,70,5,seg,NULL,CUFF.13095.1
         (223 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO018792 homologue to UniRef100_A6SBD2 Cluster: Predict...    76   1e-13
gnl|LJGI|TC74910 weakly similar to UniRef100_A7P468 Cluster: Chr...    54   4e-07
gnl|LJGI|TC71134 UniRef100_Q0P7I2 Cluster: Sst1 protein; n=1; Lo...    54   4e-07
gnl|LJGI|TC70035 weakly similar to UniRef100_A7P468 Cluster: Chr...    54   4e-07

>gnl|LJGI|GO018792 homologue to UniRef100_A6SBD2 Cluster: Predicted protein; n=1;
           Botryotinia fuckeliana B05.10|Rep: Predicted protein -
           Botryotinia fuckeliana (strain B05.10) (Noble rot
           fungus) (Botrytiscinerea), partial (24%)
          Length = 720

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 38/38 (100%)
 Strand = Plus / Plus

                                                 
Query: 136 ccagttcttcttaggttgggattgagagctttcatctc 173
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 255 ccagttcttcttaggttgggattgagagctttcatctc 292


>gnl|LJGI|TC74910 weakly similar to UniRef100_A7P468 Cluster: Chromosome chr1
           scaffold_5, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr1 scaffold_5, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (56%)
          Length = 532

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 161 gagctttcatctcctggcagtccatggacaagatccatgtgtggatc 207
           |||||||| ||| |||||| |||||||||||| ||||||| ||||||
Sbjct: 202 gagctttcgtcttctggcaatccatggacaaggtccatgtctggatc 248


>gnl|LJGI|TC71134 UniRef100_Q0P7I2 Cluster: Sst1 protein; n=1; Lotus japonicus|Rep:
           Sst1 protein - Lotus japonicus, partial (7%)
          Length = 532

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 161 gagctttcatctcctggcagtccatggacaagatccatgtgtggatc 207
           |||||||| ||| |||||| |||||||||||| ||||||| ||||||
Sbjct: 92  gagctttcgtcttctggcaatccatggacaaggtccatgtctggatc 138


>gnl|LJGI|TC70035 weakly similar to UniRef100_A7P468 Cluster: Chromosome chr1
           scaffold_5, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr1 scaffold_5, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (56%)
          Length = 554

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 161 gagctttcatctcctggcagtccatggacaagatccatgtgtggatc 207
           |||||||| ||| |||||| |||||||||||| ||||||| ||||||
Sbjct: 190 gagctttcgtcttctggcaatccatggacaaggtccatgtctggatc 236