Miyakogusa Predicted Gene

Lj0g3v0204399.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0204399.1 Non Chatacterized Hit- tr|F6HA19|F6HA19_VITVI
Putative uncharacterized protein OS=Vitis vinifera GN=,80.77,1e-16,
,CUFF.13043.1
         (156 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81682 similar to UniRef100_A7PQZ5 Cluster: Chromosome...   182   4e-46
gnl|LJGI|AV422170 homologue to UniRef100_Q84RS0 Cluster: ZR4 pro...   135   8e-32

>gnl|LJGI|TC81682 similar to UniRef100_A7PQZ5 Cluster: Chromosome chr6 scaffold_25,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_25, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (37%)
          Length = 1246

 Score =  182 bits (92), Expect = 4e-46
 Identities = 137/152 (90%)
 Strand = Plus / Plus

                                                                       
Query: 4   gttgataaggatgataaatttgattccagatctcgtaatcaacttgccaggttttcttca 63
           |||| ||||||||||||||| ||||||| |||   ||||||  ||| |||||| ||||||
Sbjct: 686 gttggtaaggatgataaattggattccaaatcaaataatcagattggcaggttctcttca 745

                                                                       
Query: 64  atggaatcattcaaacaagtggaaagcagatcttcaaagaaaaacaagaaattggaattc 123
           |||||||| || || |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 746 atggaatccttgaatcaagtggacagcagatcttcaaagaaaaataagaaattggaattc 805

                                           
Query: 124 aacagtagccgtgtctcgcctgttccaaatgg 155
           ||||||||||||||||||||||||||||||||
Sbjct: 806 aacagtagccgtgtctcgcctgttccaaatgg 837


>gnl|LJGI|AV422170 homologue to UniRef100_Q84RS0 Cluster: ZR4 protein; n=1; Medicago
           sativa|Rep: ZR4 protein - Medicago sativa (Alfalfa),
           partial (34%)
          Length = 306

 Score =  135 bits (68), Expect = 8e-32
 Identities = 89/92 (96%), Gaps = 3/92 (3%)
 Strand = Plus / Plus

                                                                       
Query: 66  ggaatcattcaaacaagtggaaagcagatcttcaaagaaaaacaag-aaattggaattca 124
           ||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||
Sbjct: 1   ggaatcattcaaaca-gtggaaagc-gatcttcaaagaaaaacaagcaaattggaattca 58

                                           
Query: 125 acagtagccgtgtctcgcctgttccaaatggg 156
           ||||||||||||||||||||||||||||||||
Sbjct: 59  acagtagccgtgtctcgcctgttccaaatggg 90