Miyakogusa Predicted Gene
- Lj0g3v0203269.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0203269.1 tr|Q9ARG2|Q9ARG2_SOYBN Amino acid transporter
OS=Glycine max PE=4 SV=1,85.41,0,Aa_trans,Amino acid transporter,
transmembrane; seg,NULL; SUBFAMILY NOT NAMED,NULL; AMINO ACID
TRANS,CUFF.12945.1
(1392 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66602 similar to UniRef100_Q9ARG2 Cluster: Amino acid... 551 e-156
gnl|LJGI|TC76614 similar to UniRef100_Q56H85 Cluster: Amino acid... 58 2e-07
gnl|LJGI|TC63583 similar to UniRef100_Q93X15 Cluster: Amino acid... 58 2e-07
gnl|LJGI|GO023712 similar to UniRef100_Q56H86 Cluster: Amino aci... 52 1e-05
>gnl|LJGI|TC66602 similar to UniRef100_Q9ARG2 Cluster: Amino acid transporter; n=1;
Glycine max|Rep: Amino acid transporter - Glycine max
(Soybean), partial (27%)
Length = 612
Score = 551 bits (278), Expect = e-156
Identities = 278/278 (100%)
Strand = Plus / Plus
Query: 1115 ttttttcccagcccttatttgcatttgttgaaaagtggattgcacgtaagtggccaaagg 1174
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ttttttcccagcccttatttgcatttgttgaaaagtggattgcacgtaagtggccaaagg 60
Query: 1175 atggtatagtcaccgcagaatatgaaattcccattccctactttggggtgtacaaactca 1234
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 atggtatagtcaccgcagaatatgaaattcccattccctactttggggtgtacaaactca 120
Query: 1235 acttcttccgcttagtatggaggaccatctttgtgatgttgactaccatcatggccatgc 1294
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 acttcttccgcttagtatggaggaccatctttgtgatgttgactaccatcatggccatgc 180
Query: 1295 tattgccttttttcaatgacattgttggaatacttggagcttttgggttctggcccttaa 1354
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tattgccttttttcaatgacattgttggaatacttggagcttttgggttctggcccttaa 240
Query: 1355 cagtttatttcccaatagacatgtacatctcacaaaag 1392
||||||||||||||||||||||||||||||||||||||
Sbjct: 241 cagtttatttcccaatagacatgtacatctcacaaaag 278
>gnl|LJGI|TC76614 similar to UniRef100_Q56H85 Cluster: Amino acid transporter; n=1;
Pisum sativum|Rep: Amino acid transporter - Pisum
sativum (Garden pea), partial (51%)
Length = 917
Score = 58.0 bits (29), Expect = 2e-07
Identities = 62/73 (84%)
Strand = Plus / Plus
Query: 617 tttcccaaatcccagactttgatcaagtatggtggctatccatagttgcagctatcatgt 676
|||| ||||| ||||| ||| ||||| ||||||||| || ||| ||||||| |||||||
Sbjct: 671 tttctcaaattccagattttcatcaaacatggtggctctcaatacttgcagcaatcatgt 730
Query: 677 cattcacttattc 689
| |||||||||||
Sbjct: 731 ctttcacttattc 743
>gnl|LJGI|TC63583 similar to UniRef100_Q93X15 Cluster: Amino acid permease AAP1; n=1;
Vicia faba var. minor|Rep: Amino acid permease AAP1 -
Vicia faba var. minor, partial (72%)
Length = 1233
Score = 58.0 bits (29), Expect = 2e-07
Identities = 62/73 (84%)
Strand = Plus / Plus
Query: 617 tttcccaaatcccagactttgatcaagtatggtggctatccatagttgcagctatcatgt 676
|||| ||||| ||||| ||| ||||| ||||||||| || ||| ||||||| |||||||
Sbjct: 169 tttctcaaattccagattttcatcaaacatggtggctctcaatacttgcagcaatcatgt 228
Query: 677 cattcacttattc 689
| |||||||||||
Sbjct: 229 ctttcacttattc 241
Score = 52.0 bits (26), Expect = 1e-05
Identities = 56/66 (84%)
Strand = Plus / Plus
Query: 1327 cttggagcttttgggttctggcccttaacagtttatttcccaatagacatgtacatctca 1386
|||||||| || || || ||||| |||||||||||||||||| | || ||||| ||| ||
Sbjct: 854 cttggagcattgggattttggcctttaacagtttatttcccagtggagatgtatatcaca 913
Query: 1387 caaaag 1392
||||||
Sbjct: 914 caaaag 919
>gnl|LJGI|GO023712 similar to UniRef100_Q56H86 Cluster: Amino acid transporter; n=1;
Pisum sativum|Rep: Amino acid transporter - Pisum
sativum (Garden pea), partial (41%)
Length = 731
Score = 52.0 bits (26), Expect = 1e-05
Identities = 80/98 (81%)
Strand = Plus / Plus
Query: 208 catatcatcactgctataataggctcaggagtactttcactggcatgggctgtggctcag 267
|||||||| |||||| | || ||||| || || || || ||||| ||| || | ||||||
Sbjct: 223 catatcataactgctgtgattggctctggggttctctccctggcttggactatagctcag 282
Query: 268 cttggctgggttgctggacctgttatcatgcttctctt 305
||||| ||||||||||| |||| | ||||| |||||||
Sbjct: 283 cttggatgggttgctggtcctgctgtcatgattctctt 320