Miyakogusa Predicted Gene

Lj0g3v0203009.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0203009.1 Non Chatacterized Hit- tr|I1KKW2|I1KKW2_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,86.3,6e-31,Actin-like
ATPase domain,NULL; HEATSHOCK70,Heat shock protein 70 family;
HSP70_1,Heat shock protein ,CUFF.12926.1
         (224 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shoc...   155   1e-37
gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shoc...   141   2e-33
gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shoc...   139   8e-33
gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shoc...   137   3e-32
gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shoc...    94   4e-19

>gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (13%)
          Length = 290

 Score =  155 bits (78), Expect = 1e-37
 Identities = 162/190 (85%)
 Strand = Plus / Plus

                                                                       
Query: 31  ggaatcgacctcggcacgacgtactcatgtgttgcagtatgggaagagcaacactgtcga 90
           ||||||||||| ||||| ||||| || ||||||||||| ||| | | ||||||| || ||
Sbjct: 87  ggaatcgaccttggcacaacgtattcttgtgttgcagtgtggcaggggcaacacagtaga 146

                                                                       
Query: 91  gtggagatcatccacaatgaccaaggaaacaaaaccactccttcttttgttgctttcaca 150
           ||||||||  ||||||||||||| || ||||||| ||| |||||||||||||||||||||
Sbjct: 147 gtggagattgtccacaatgaccagggcaacaaaatcacaccttcttttgttgctttcaca 206

                                                                       
Query: 151 gatcaccaaagattgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaac 210
            |  |||| |||||| |||| ||||||||||||||||| ||||| || |||||||  |||
Sbjct: 207 caagaccagagattgcttggtgatgctgctaaaaatcaagctgctaccaacccagagaac 266

                     
Query: 211 actgtctttg 220
           || |||||||
Sbjct: 267 acagtctttg 276


>gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (24%)
          Length = 554

 Score =  141 bits (71), Expect = 2e-33
 Identities = 113/127 (88%)
 Strand = Plus / Plus

                                                                       
Query: 94  gagatcatccacaatgaccaaggaaacaaaaccactccttcttttgttgctttcacagat 153
           |||||||| | |||||| |||||||||| |||||||||||| || ||||||||||| |||
Sbjct: 187 gagatcattcccaatgaacaaggaaacagaaccactccttccttggttgctttcactgat 246

                                                                       
Query: 154 caccaaagattgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacact 213
              |||||||| ||||| |||||||| |||||||||||||||||||||||| ||||||||
Sbjct: 247 acacaaagattaattggtgatgctgccaaaaatcaggctgcaacaaacccatcaaacact 306

                  
Query: 214 gtctttg 220
           |||||||
Sbjct: 307 gtctttg 313


>gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (24%)
          Length = 681

 Score =  139 bits (70), Expect = 8e-33
 Identities = 151/178 (84%)
 Strand = Plus / Plus

                                                                       
Query: 43  ggcacgacgtactcatgtgttgcagtatgggaagagcaacactgtcgagtggagatcatc 102
           ||||| || ||||||||||||||  |||| ||||| ||  ||  |||||  || ||||| 
Sbjct: 265 ggcaccacctactcatgtgttgctatatgagaagaacagaacaatcgagctgaaatcatt 324

                                                                       
Query: 103 cacaatgaccaaggaaacaaaaccactccttcttttgttgctttcacagatcaccaaaga 162
           |||||||| |||||||| | |||||  ||||| || ||||||||||| |||  |||||||
Sbjct: 325 cacaatgaacaaggaaatagaaccatgccttccttggttgctttcactgatacccaaaga 384

                                                                     
Query: 163 ttgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacactgtctttg 220
           |||||||| ||||||||||||||||||||||||||||||||  |||||||||||||||
Sbjct: 385 ttgattggtgatgctgctaaaaatcaggctgcaacaaacccgtcaaacactgtctttg 442


>gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (11%)
          Length = 385

 Score =  137 bits (69), Expect = 3e-32
 Identities = 111/125 (88%)
 Strand = Plus / Plus

                                                                       
Query: 94  gagatcatccacaatgaccaaggaaacaaaaccactccttcttttgttgctttcacagat 153
           ||||||||||||||||| |||||||| | ||||||||| ||||||||||||||||| |||
Sbjct: 238 gagatcatccacaatgagcaaggaaatagaaccactccctcttttgttgctttcactgat 297

                                                                       
Query: 154 caccaaagattgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacact 213
             ||||||  ||||||| |||||||| |||||||||||||| ||||||||| | ||||||
Sbjct: 298 acccaaaggctgattggagatgctgcaaaaaatcaggctgccacaaacccaaccaacact 357

                
Query: 214 gtctt 218
           |||||
Sbjct: 358 gtctt 362


>gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (35%)
          Length = 731

 Score = 93.7 bits (47), Expect = 4e-19
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                       
Query: 106 aatgaccaaggaaacaaaaccactccttcttttgttgctttcacagatcaccaaagattg 165
           ||||| ||||| |||||||  ||||| || |||||||||||||| ||| | ||||| |||
Sbjct: 164 aatgaacaaggcaacaaaattactccctcctttgttgctttcactgatgatcaaaggttg 223

                                                                  
Query: 166 attggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacactgtctttg 220
           ||||| ||||| ||||| ||||||||||| |||||||| |  |||||||||||||
Sbjct: 224 attggtgatgcagctaagaatcaggctgctacaaaccctgagaacactgtctttg 278