Miyakogusa Predicted Gene
- Lj0g3v0203009.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0203009.1 Non Chatacterized Hit- tr|I1KKW2|I1KKW2_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,86.3,6e-31,Actin-like
ATPase domain,NULL; HEATSHOCK70,Heat shock protein 70 family;
HSP70_1,Heat shock protein ,CUFF.12926.1
(224 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shoc... 155 1e-37
gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shoc... 141 2e-33
gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shoc... 139 8e-33
gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shoc... 137 3e-32
gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shoc... 94 4e-19
>gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (13%)
Length = 290
Score = 155 bits (78), Expect = 1e-37
Identities = 162/190 (85%)
Strand = Plus / Plus
Query: 31 ggaatcgacctcggcacgacgtactcatgtgttgcagtatgggaagagcaacactgtcga 90
||||||||||| ||||| ||||| || ||||||||||| ||| | | ||||||| || ||
Sbjct: 87 ggaatcgaccttggcacaacgtattcttgtgttgcagtgtggcaggggcaacacagtaga 146
Query: 91 gtggagatcatccacaatgaccaaggaaacaaaaccactccttcttttgttgctttcaca 150
|||||||| ||||||||||||| || ||||||| ||| |||||||||||||||||||||
Sbjct: 147 gtggagattgtccacaatgaccagggcaacaaaatcacaccttcttttgttgctttcaca 206
Query: 151 gatcaccaaagattgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaac 210
| |||| |||||| |||| ||||||||||||||||| ||||| || ||||||| |||
Sbjct: 207 caagaccagagattgcttggtgatgctgctaaaaatcaagctgctaccaacccagagaac 266
Query: 211 actgtctttg 220
|| |||||||
Sbjct: 267 acagtctttg 276
>gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (24%)
Length = 554
Score = 141 bits (71), Expect = 2e-33
Identities = 113/127 (88%)
Strand = Plus / Plus
Query: 94 gagatcatccacaatgaccaaggaaacaaaaccactccttcttttgttgctttcacagat 153
|||||||| | |||||| |||||||||| |||||||||||| || ||||||||||| |||
Sbjct: 187 gagatcattcccaatgaacaaggaaacagaaccactccttccttggttgctttcactgat 246
Query: 154 caccaaagattgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacact 213
|||||||| ||||| |||||||| |||||||||||||||||||||||| ||||||||
Sbjct: 247 acacaaagattaattggtgatgctgccaaaaatcaggctgcaacaaacccatcaaacact 306
Query: 214 gtctttg 220
|||||||
Sbjct: 307 gtctttg 313
>gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (24%)
Length = 681
Score = 139 bits (70), Expect = 8e-33
Identities = 151/178 (84%)
Strand = Plus / Plus
Query: 43 ggcacgacgtactcatgtgttgcagtatgggaagagcaacactgtcgagtggagatcatc 102
||||| || |||||||||||||| |||| ||||| || || ||||| || |||||
Sbjct: 265 ggcaccacctactcatgtgttgctatatgagaagaacagaacaatcgagctgaaatcatt 324
Query: 103 cacaatgaccaaggaaacaaaaccactccttcttttgttgctttcacagatcaccaaaga 162
|||||||| |||||||| | ||||| ||||| || ||||||||||| ||| |||||||
Sbjct: 325 cacaatgaacaaggaaatagaaccatgccttccttggttgctttcactgatacccaaaga 384
Query: 163 ttgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacactgtctttg 220
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 385 ttgattggtgatgctgctaaaaatcaggctgcaacaaacccgtcaaacactgtctttg 442
>gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (11%)
Length = 385
Score = 137 bits (69), Expect = 3e-32
Identities = 111/125 (88%)
Strand = Plus / Plus
Query: 94 gagatcatccacaatgaccaaggaaacaaaaccactccttcttttgttgctttcacagat 153
||||||||||||||||| |||||||| | ||||||||| ||||||||||||||||| |||
Sbjct: 238 gagatcatccacaatgagcaaggaaatagaaccactccctcttttgttgctttcactgat 297
Query: 154 caccaaagattgattggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacact 213
|||||| ||||||| |||||||| |||||||||||||| ||||||||| | ||||||
Sbjct: 298 acccaaaggctgattggagatgctgcaaaaaatcaggctgccacaaacccaaccaacact 357
Query: 214 gtctt 218
|||||
Sbjct: 358 gtctt 362
>gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (35%)
Length = 731
Score = 93.7 bits (47), Expect = 4e-19
Identities = 98/115 (85%)
Strand = Plus / Plus
Query: 106 aatgaccaaggaaacaaaaccactccttcttttgttgctttcacagatcaccaaagattg 165
||||| ||||| ||||||| ||||| || |||||||||||||| ||| | ||||| |||
Sbjct: 164 aatgaacaaggcaacaaaattactccctcctttgttgctttcactgatgatcaaaggttg 223
Query: 166 attggcgatgctgctaaaaatcaggctgcaacaaacccagcaaacactgtctttg 220
||||| ||||| ||||| ||||||||||| |||||||| | |||||||||||||
Sbjct: 224 attggtgatgcagctaagaatcaggctgctacaaaccctgagaacactgtctttg 278