Miyakogusa Predicted Gene

Lj0g3v0201709.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0201709.1 Non Chatacterized Hit- tr|I1JJ19|I1JJ19_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,65.58,0,DISEASERSIST,Disease resistance protein; Toll/Interleukin
receptor TIR domain,Toll/interleukin-1 rec,CUFF.12822.1
         (2559 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR re...    78   3e-13
gnl|LJGI|FS341004 weakly similar to UniRef100_Q9FVK2 Cluster: Re...    72   2e-11
gnl|LJGI|FS339995 similar to UniRef100_A7PPY4 Cluster: Chromosom...    64   5e-09
gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistanc...    64   5e-09
gnl|LJGI|TC81841 similar to UniRef100_A7QHI1 Cluster: Chromosome...    58   3e-07
gnl|LJGI|TC74896 weakly similar to UniRef100_A3QVH1 Cluster: Tol...    58   3e-07

>gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR resistance-like
           protein RGC754; n=1; Helianthus tuberosus|Rep: NBS-LRR
           resistance-like protein RGC754 - Helianthus tuberosus
           (Jerusalem artichoke), partial (61%)
          Length = 749

 Score = 77.8 bits (39), Expect = 3e-13
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 886 gttcttttggttcttgatgatgttgatgacagacaacagttgaaaaacctggcaggagga 945
           ||||| ||| |||| |||||||||||||| | | |||| ||| ||   || || ||||||
Sbjct: 474 gttctattgattctggatgatgttgatgatatagaacaattggaagcacttgccggagga 533

                                                              
Query: 946 tgcgattggtttggtccaggtagcaggatcattataacaacgagggatgaa 996
           || |||||||||||| | ||||||||||||||||||||||| || ||||||
Sbjct: 534 tgtgattggtttggttccggtagcaggatcattataacaacaagagatgaa 584


>gnl|LJGI|FS341004 weakly similar to UniRef100_Q9FVK2 Cluster: Resistance protein
           MG13; n=1; Glycine max|Rep: Resistance protein MG13 -
           Glycine max (Soybean), partial (28%)
          Length = 770

 Score = 71.9 bits (36), Expect = 2e-11
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 542 ctaaacctttacctggtgaggacccagttggacttgagcaacgcacaaaagaggtgacat 601
           |||||||||| | |||| |||||||||||||| |||||||||||| | ||||||| |  |
Sbjct: 635 ctaaaccttttcatggtaaggacccagttggatttgagcaacgcatagaagaggtaaatt 694

                           
Query: 602 cacttctagacatgaa 617
           |||||||||| |||||
Sbjct: 695 cacttctagaaatgaa 710



 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 221 tttctgagaattatgcaacttccacatggtg 251
           ||||||||||||||||| |||||||||||||
Sbjct: 317 tttctgagaattatgcatcttccacatggtg 347


>gnl|LJGI|FS339995 similar to UniRef100_A7PPY4 Cluster: Chromosome chr18 scaffold_24,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_24, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (16%)
          Length = 711

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 tgctcttcccaaagccattcttgaatctaagattttgattattgtgttttctgagaatta 233
           ||||||| |||||||||||   ||||| | | |||| ||||| ||| ||||| |||| ||
Sbjct: 230 tgctctttccaaagccattgaagaatccatggttttaattatagtgctttctaagaacta 289

                                                   
Query: 234 tgcaacttccacatggtgtcttgacgaactagtcaagatt 273
           |||| |||| || |||||||||||||| || |||||||||
Sbjct: 290 tgcatcttctacttggtgtcttgacgagctcgtcaagatt 329


>gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistance protein PLTR; n=1;
           Arachis hypogaea|Rep: Resistance protein PLTR - Arachis
           hypogaea (Peanut), partial (46%)
          Length = 350

 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 104/128 (81%)
 Strand = Plus / Plus

                                                                       
Query: 866 gcagacttagcaagaaaaatgttcttttggttcttgatgatgttgatgacagacaacagt 925
           |||| |||||||| ||||  |||||| | ||||| |||||||||||  | | | ||||||
Sbjct: 62  gcaggcttagcaacaaaagagttcttctagttctggatgatgttgacaaaataaaacagt 121

                                                                       
Query: 926 tgaaaaacctggcaggaggatgcgattggtttggtccaggtagcaggatcattataacaa 985
           || ||   ||||| || ||| | |||||||||||| | |||||||||||||| |||||||
Sbjct: 122 tgcaagcactggctgggggaggtgattggtttggttctggtagcaggatcatcataacaa 181

                   
Query: 986 cgagggat 993
           | ||||||
Sbjct: 182 caagggat 189


>gnl|LJGI|TC81841 similar to UniRef100_A7QHI1 Cluster: Chromosome chr5 scaffold_98,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_98, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (9%)
          Length = 561

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 40  gatgtcttcctcagttttagaggtgaaga 68
           |||||||||||||||||||||||||||||
Sbjct: 361 gatgtcttcctcagttttagaggtgaaga 389


>gnl|LJGI|TC74896 weakly similar to UniRef100_A3QVH1 Cluster: Toll interleukin
           receptor; n=1; Phaseolus vulgaris|Rep: Toll interleukin
           receptor - Phaseolus vulgaris (Kidney bean) (French
           bean), partial (31%)
          Length = 701

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 211 attattgtgttttctgagaattatgcaacttccacatggtgtcttgacgaact 263
           |||||||| |||||||||||||||| |  |||| ||||||||||||| |||||
Sbjct: 118 attattgttttttctgagaattatggatattcctcatggtgtcttgatgaact 170