Miyakogusa Predicted Gene
- Lj0g3v0201709.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0201709.1 Non Chatacterized Hit- tr|I1JJ19|I1JJ19_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,65.58,0,DISEASERSIST,Disease resistance protein; Toll/Interleukin
receptor TIR domain,Toll/interleukin-1 rec,CUFF.12822.1
(2559 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR re... 78 3e-13
gnl|LJGI|FS341004 weakly similar to UniRef100_Q9FVK2 Cluster: Re... 72 2e-11
gnl|LJGI|FS339995 similar to UniRef100_A7PPY4 Cluster: Chromosom... 64 5e-09
gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistanc... 64 5e-09
gnl|LJGI|TC81841 similar to UniRef100_A7QHI1 Cluster: Chromosome... 58 3e-07
gnl|LJGI|TC74896 weakly similar to UniRef100_A3QVH1 Cluster: Tol... 58 3e-07
>gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR resistance-like
protein RGC754; n=1; Helianthus tuberosus|Rep: NBS-LRR
resistance-like protein RGC754 - Helianthus tuberosus
(Jerusalem artichoke), partial (61%)
Length = 749
Score = 77.8 bits (39), Expect = 3e-13
Identities = 93/111 (83%)
Strand = Plus / Plus
Query: 886 gttcttttggttcttgatgatgttgatgacagacaacagttgaaaaacctggcaggagga 945
||||| ||| |||| |||||||||||||| | | |||| ||| || || || ||||||
Sbjct: 474 gttctattgattctggatgatgttgatgatatagaacaattggaagcacttgccggagga 533
Query: 946 tgcgattggtttggtccaggtagcaggatcattataacaacgagggatgaa 996
|| |||||||||||| | ||||||||||||||||||||||| || ||||||
Sbjct: 534 tgtgattggtttggttccggtagcaggatcattataacaacaagagatgaa 584
>gnl|LJGI|FS341004 weakly similar to UniRef100_Q9FVK2 Cluster: Resistance protein
MG13; n=1; Glycine max|Rep: Resistance protein MG13 -
Glycine max (Soybean), partial (28%)
Length = 770
Score = 71.9 bits (36), Expect = 2e-11
Identities = 66/76 (86%)
Strand = Plus / Plus
Query: 542 ctaaacctttacctggtgaggacccagttggacttgagcaacgcacaaaagaggtgacat 601
|||||||||| | |||| |||||||||||||| |||||||||||| | ||||||| | |
Sbjct: 635 ctaaaccttttcatggtaaggacccagttggatttgagcaacgcatagaagaggtaaatt 694
Query: 602 cacttctagacatgaa 617
|||||||||| |||||
Sbjct: 695 cacttctagaaatgaa 710
Score = 54.0 bits (27), Expect = 4e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 221 tttctgagaattatgcaacttccacatggtg 251
||||||||||||||||| |||||||||||||
Sbjct: 317 tttctgagaattatgcatcttccacatggtg 347
>gnl|LJGI|FS339995 similar to UniRef100_A7PPY4 Cluster: Chromosome chr18 scaffold_24,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr18 scaffold_24, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (16%)
Length = 711
Score = 63.9 bits (32), Expect = 5e-09
Identities = 83/100 (83%)
Strand = Plus / Plus
Query: 174 tgctcttcccaaagccattcttgaatctaagattttgattattgtgttttctgagaatta 233
||||||| ||||||||||| ||||| | | |||| ||||| ||| ||||| |||| ||
Sbjct: 230 tgctctttccaaagccattgaagaatccatggttttaattatagtgctttctaagaacta 289
Query: 234 tgcaacttccacatggtgtcttgacgaactagtcaagatt 273
|||| |||| || |||||||||||||| || |||||||||
Sbjct: 290 tgcatcttctacttggtgtcttgacgagctcgtcaagatt 329
>gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistance protein PLTR; n=1;
Arachis hypogaea|Rep: Resistance protein PLTR - Arachis
hypogaea (Peanut), partial (46%)
Length = 350
Score = 63.9 bits (32), Expect = 5e-09
Identities = 104/128 (81%)
Strand = Plus / Plus
Query: 866 gcagacttagcaagaaaaatgttcttttggttcttgatgatgttgatgacagacaacagt 925
|||| |||||||| |||| |||||| | ||||| ||||||||||| | | | ||||||
Sbjct: 62 gcaggcttagcaacaaaagagttcttctagttctggatgatgttgacaaaataaaacagt 121
Query: 926 tgaaaaacctggcaggaggatgcgattggtttggtccaggtagcaggatcattataacaa 985
|| || ||||| || ||| | |||||||||||| | |||||||||||||| |||||||
Sbjct: 122 tgcaagcactggctgggggaggtgattggtttggttctggtagcaggatcatcataacaa 181
Query: 986 cgagggat 993
| ||||||
Sbjct: 182 caagggat 189
>gnl|LJGI|TC81841 similar to UniRef100_A7QHI1 Cluster: Chromosome chr5 scaffold_98,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_98, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (9%)
Length = 561
Score = 58.0 bits (29), Expect = 3e-07
Identities = 29/29 (100%)
Strand = Plus / Plus
Query: 40 gatgtcttcctcagttttagaggtgaaga 68
|||||||||||||||||||||||||||||
Sbjct: 361 gatgtcttcctcagttttagaggtgaaga 389
>gnl|LJGI|TC74896 weakly similar to UniRef100_A3QVH1 Cluster: Toll interleukin
receptor; n=1; Phaseolus vulgaris|Rep: Toll interleukin
receptor - Phaseolus vulgaris (Kidney bean) (French
bean), partial (31%)
Length = 701
Score = 58.0 bits (29), Expect = 3e-07
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 211 attattgtgttttctgagaattatgcaacttccacatggtgtcttgacgaact 263
|||||||| |||||||||||||||| | |||| ||||||||||||| |||||
Sbjct: 118 attattgttttttctgagaattatggatattcctcatggtgtcttgatgaact 170