Miyakogusa Predicted Gene

Lj0g3v0200849.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0200849.1 Non Chatacterized Hit- tr|K4DA52|K4DA52_SOLLC
Uncharacterized protein OS=Solanum lycopersicum GN=Sol,34.31,7e-18,no
description,Homeodomain-like; seg,NULL; HOMEOBOX PROTEIN
KNOTTED-1-RELATED,NULL; HOMEOBOX PROTEIN,CUFF.12749.1
         (765 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV419283 homologue to UniRef100_Q8LLD9 Cluster: BEL1-re...    54   1e-06

>gnl|LJGI|AV419283 homologue to UniRef100_Q8LLD9 Cluster: BEL1-related homeotic
          protein 29; n=1; Solanum tuberosum|Rep: BEL1-related
          homeotic protein 29 - Solanum tuberosum (Potato),
          partial (6%)
          Length = 155

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                      
Query: 4  caggtatcaaactggtttatcaatgcccgagttcgcctgtggaaaccaatggttgaggaa 63
          |||||||| || ||||||||||||||  | ||  | || ||||| |||||||| ||||||
Sbjct: 3  caggtatcgaaatggtttatcaatgcaagggtgaggctatggaagccaatggtagaggaa 62

                         
Query: 64 atgtacatggaagaa 78
          |||||| ||||||||
Sbjct: 63 atgtacttggaagaa 77