Miyakogusa Predicted Gene

Lj0g3v0200439.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0200439.1 tr|Q9FLE0|Q9FLE0_ARATH GTP-binding protein-like
OS=Arabidopsis thaliana GN=At5g39960 PE=4 SV=1,80,5e-19,MMR_HSR1,GTP
binding domain; no description,NULL; P-loop containing nucleoside
triphosphate hydrolas,CUFF.12715.1
         (368 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV780365 similar to UniRef100_A7QGU3 Cluster: Chromosom...    52   2e-06

>gnl|LJGI|AV780365 similar to UniRef100_A7QGU3 Cluster: Chromosome chr16 scaffold_94,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr16 scaffold_94, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (12%)
          Length = 551

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 335 atccttcaccaaaccgcttccatcactgctaatc 368
           ||||||||||  ||||||||||||||||||||||
Sbjct: 550 atccttcaccttaccgcttccatcactgctaatc 517