Miyakogusa Predicted Gene

Lj0g3v0200139.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0200139.1 Non Chatacterized Hit- tr|G7JI35|G7JI35_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,37.63,2e-18,seg,NULL; Leucine-rich repeat - CC
(cysteine-containin,Leucine-rich repeat, cysteine-containing
subt,CUFF.12691.1
         (1681 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS322002 weakly similar to UniRef100_A9U3I4 Cluster: Pr...    58   2e-07

>gnl|LJGI|FS322002 weakly similar to UniRef100_A9U3I4 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (14%)
          Length = 682

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 70  ttggagtctctatctcttgtctgcaagcaattcctttccatcacaaacc 118
           ||||||||||| || ||||||| |||||||||||| |||||||| ||||
Sbjct: 115 ttggagtctctgtcccttgtctccaagcaattcctctccatcaccaacc 163