Miyakogusa Predicted Gene
- Lj0g3v0198019.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0198019.1 Non Chatacterized Hit- tr|I1LAD8|I1LAD8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,42.44,3e-19,F_box_assoc_1: F-box protein interaction domain,F-box
associated interaction domain; FBA_1,F-box ass,CUFF.12560.1
(570 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC79595 161 6e-39
gnl|LJGI|TC58640 similar to UniRef100_A7Q9Q0 Cluster: Chromosome... 153 1e-36
gnl|LJGI|TC74519 90 2e-17
gnl|LJGI|TC81656 84 1e-15
gnl|LJGI|TC70514 weakly similar to UniRef100_A7Q430 Cluster: Chr... 76 3e-13
gnl|LJGI|TC73315 similar to UniRef100_O65848 Cluster: Annexin; n... 58 6e-08
gnl|LJGI|TC67215 similar to UniRef100_A7Q9Q0 Cluster: Chromosome... 58 6e-08
gnl|LJGI|AV775266 UniRef100_Q02CM3 Cluster: Acetolactate synthas... 52 4e-06
>gnl|LJGI|TC79595
Length = 1392
Score = 161 bits (81), Expect = 6e-39
Identities = 96/101 (95%)
Strand = Plus / Plus
Query: 470 aaggagaacagctgaagcattgggagtattttggttttctagaatttaacgtgcccatgt 529
|||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 1126 aaggagaacagctggagcattgggggtgttttggttttctagaatttaacgtgcccatgt 1185
Query: 530 atacagagtctatgctttcactccctggtgccaatgagtga 570
||||||||| ||||||||||||| |||||||||||||||||
Sbjct: 1186 atacagagtatatgctttcactctctggtgccaatgagtga 1226
>gnl|LJGI|TC58640 similar to UniRef100_A7Q9Q0 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (15%)
Length = 1577
Score = 153 bits (77), Expect = 1e-36
Identities = 226/275 (82%), Gaps = 3/275 (1%)
Strand = Plus / Plus
Query: 95 ctggattgctcttcaatgaggccatccattggttggcttacgatcgtgataaattggtga 154
|||| ||||||||||| ||| |||| || ||||||||||| |||| ||||| ||| |||
Sbjct: 958 ctgggttgctcttcaacgagaccattcactggttggcttatgatcatgatagattactga 1017
Query: 155 atgttattattgcctttgatttaattgaaaaggcatttttagagataccccgaccaggtg 214
|||||||||||||||||||||||| || ||| | || ||||||| |||| ||||| ||
Sbjct: 1018 atgttattattgcctttgatttaacggagaagagacttctagagattccccaaccagatg 1077
Query: 215 atcttgtccatgatttttcattttgtaaattgtgggtgcatgggaactttttgagtctat 274
|||||| ||| |||||| |||||| ||||||||||| || | |||||||||||||
Sbjct: 1078 atcttgcttgtgacctttcatattgtaatttgtgggtgcacggaagatttttgagtctat 1137
Query: 275 cagtggttagcgagaacaatacacttgaaatatgggttatggaaaagtacaaagtacaat 334
| ||||||| | ||||| |||||||||||||||||||||| ||||||||||| |
Sbjct: 1138 c---ggttagcaggttttatacaattgaaatatgggttatggaaaaatacaaagtacact 1194
Query: 335 catcttggaccaagtctcttgttctatctttgagt 369
| |||||||||||| | ||||||| |||||||||
Sbjct: 1195 cttcttggaccaagaccattgttctctctttgagt 1229
Score = 75.8 bits (38), Expect = 3e-13
Identities = 95/114 (83%)
Strand = Plus / Plus
Query: 446 caaaactggtgaagtatagtgataaaggagaacagctgaagcattgggagtattttggtt 505
|||| ||| |||||| || ||||||||||||| | || ||||||| | |||| ||||
Sbjct: 1285 caaatctgctgaagtttactgataaaggagaatacctagagcattgcgcgtatcctggtc 1344
Query: 506 ttctagaatttaacgtgcccatgtatacagagtctatgctttcactccctggtg 559
||||||||| | ||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 1345 ttctagaatcccaggtgcccatgtatacagagtctatcctttcactccccggtg 1398
>gnl|LJGI|TC74519
Length = 592
Score = 89.7 bits (45), Expect = 2e-17
Identities = 60/65 (92%)
Strand = Plus / Plus
Query: 293 atacacttgaaatatgggttatggaaaagtacaaagtacaatcatcttggaccaagtctc 352
||||| ||||||||||||||||| | || ||||||||||||||||||||||||||| |||
Sbjct: 212 atacaattgaaatatgggttatgaagaaatacaaagtacaatcatcttggaccaagactc 271
Query: 353 ttgtt 357
|||||
Sbjct: 272 ttgtt 276
Score = 58.0 bits (29), Expect = 6e-08
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 520 gtgcccatgtatacagagtctatgctttcactccctg 556
|||||| |||||||||||||||||||||| |||||||
Sbjct: 430 gtgcccttgtatacagagtctatgctttcgctccctg 466
Score = 56.0 bits (28), Expect = 2e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 158 ttattattgcctttgatttaattgaaaaggcatttttagagatacccc 205
|||| ||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 50 ttatcattgcctttgatttaatggaaaagagacttttagagatacccc 97
>gnl|LJGI|TC81656
Length = 1322
Score = 83.8 bits (42), Expect = 1e-15
Identities = 234/296 (79%), Gaps = 9/296 (3%)
Strand = Plus / Plus
Query: 83 gtgatcggatacctggattgctcttcaatgaggccatccattggttggcttacgatcgtg 142
||||||| | ||| || ||||||||||| |||||||| || ||| ||||||| || | ||
Sbjct: 727 gtgatcgaagacccgggttgctcttcaacgaggccattcactgggtggcttatgaccatg 786
Query: 143 ataaattggtgaatgttattattgcctttgatttaattgaaaaggcatttttagagatac 202
|||||| || |||||||||||| ||||||||| || |||||| | ||||||||||||
Sbjct: 787 ataaatcaatggatgttattattgtctttgatttgatggaaaagagaattttagagatac 846
Query: 203 c---ccga---ccaggtgatcttgtccatgatttttcattttgtaaattgtgggtgcatg 256
| || | |||| |||||||| || | | |||||| |||||| ||||||||| |||
Sbjct: 847 cgcacccagacccagttgatcttgcccgtcgtctttcatcttgtaatttgtgggtgtatg 906
Query: 257 ggaactttttgagtctatcagtggttagcgagaacaatacacttgaaatatgggttatgg 316
| | |||||||||||||| ||||| || ||| | ||||||||| |||||||
Sbjct: 907 gaagatttttgagtctatc---ggttaagaggagggataaatttgaaatatttgttatgg 963
Query: 317 aaaagtacaaagtacaatcatcttggaccaagtctcttgttctatctttgagtggc 372
| || ||||||| ||| || |||||||||||| | ||||||||||||||||||||
Sbjct: 964 ataattacaaagcacagtcttcttggaccaagaccattgttctatctttgagtggc 1019
Score = 71.9 bits (36), Expect = 4e-12
Identities = 93/112 (83%)
Strand = Plus / Plus
Query: 448 aaactggtgaagtatagtgataaaggagaacagctgaagcattgggagtattttggtttt 507
|||||||||||||||| |||||| |||||||| || ||||||| || ||| ||||| |
Sbjct: 1074 aaactggtgaagtatactgataatggagaacaactagagcattgcgaatatcgtggttat 1133
Query: 508 ctagaatttaacgtgcccatgtatacagagtctatgctttcactccctggtg 559
||||||| |||||||| |||| |||||| |||||||||||||| ||||
Sbjct: 1134 ctagaatcccgggtgcccatctatatagagtcgatgctttcactcccgggtg 1185
>gnl|LJGI|TC70514 weakly similar to UniRef100_A7Q430 Cluster: Chromosome chr13
scaffold_48, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr13 scaffold_48, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (12%)
Length = 842
Score = 75.8 bits (38), Expect = 3e-13
Identities = 59/66 (89%)
Strand = Plus / Plus
Query: 300 tgaaatatgggttatggaaaagtacaaagtacaatcatcttggaccaagtctcttgttct 359
|||||||||||||||| | || ||||||||||| |||||||||||||| || |||||||
Sbjct: 18 tgaaatatgggttatgaagaaatacaaagtacagacatcttggaccaagactgttgttct 77
Query: 360 atcttt 365
||||||
Sbjct: 78 atcttt 83
Score = 52.0 bits (26), Expect = 4e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 527 tgtatacagagtctatgctttcactccctg 556
||||||||||||| ||||||||||||||||
Sbjct: 248 tgtatacagagtcaatgctttcactccctg 277
>gnl|LJGI|TC73315 similar to UniRef100_O65848 Cluster: Annexin; n=1; Medicago
truncatula|Rep: Annexin - Medicago truncatula (Barrel
medic), partial (16%)
Length = 635
Score = 58.0 bits (29), Expect = 6e-08
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 520 gtgcccatgtatacagagtctatgctttcactccctg 556
|||||||| ||||||||||| ||||||||||||||||
Sbjct: 209 gtgcccatatatacagagtcaatgctttcactccctg 245
Score = 52.0 bits (26), Expect = 4e-06
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 303 aatatgggttatggaaaagtacaaagtacaatcatcttggaccaag 348
||||||||||||| | || ||||||||||| ||||||||||||||
Sbjct: 1 aatatgggttatgaagaaatacaaagtacagacatcttggaccaag 46
>gnl|LJGI|TC67215 similar to UniRef100_A7Q9Q0 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (15%)
Length = 1843
Score = 58.0 bits (29), Expect = 6e-08
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 520 gtgcccatgtatacagagtctatgctttcactccctg 556
|||||||| ||||||||||| ||||||||||||||||
Sbjct: 1376 gtgcccatatatacagagtcaatgctttcactccctg 1412
Score = 54.0 bits (27), Expect = 1e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 158 ttattattgcctttgatttaattgaaaaggcatttttagagataccc 204
|||||||||||||||||||||| |||||| | | ||||||||||||
Sbjct: 1029 ttattattgcctttgatttaatggaaaagagactcttagagataccc 1075
>gnl|LJGI|AV775266 UniRef100_Q02CM3 Cluster: Acetolactate synthase, small subunit;
n=1; Solibacter usitatus Ellin6076|Rep: Acetolactate
synthase, small subunit - Solibacter usitatus (strain
Ellin6076), partial (7%)
Length = 450
Score = 52.0 bits (26), Expect = 4e-06
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 523 cccatgtatacagagtctatgctttcactccctg 556
||||| ||||||||||| ||||||||||||||||
Sbjct: 450 cccatatatacagagtcaatgctttcactccctg 417