Miyakogusa Predicted Gene

Lj0g3v0195949.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0195949.1 Non Chatacterized Hit- tr|I1MLF1|I1MLF1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.57040
PE,97.3,0.0000000000004,no description,NULL; ACTIN-RELATED PROTEIN 2,
ARP2,NULL; ACTIN,Actin-like; Actin,Actin-like;
Actin-l,BP074351.path2.1
         (151 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP074351 homologue to UniRef100_A7P9Y2 Cluster: Chromos...   299   2e-81
gnl|LJGI|TC58542 homologue to UniRef100_A7P9Y2 Cluster: Chromoso...   206   3e-53

>gnl|LJGI|BP074351 homologue to UniRef100_A7P9Y2 Cluster: Chromosome chr14 scaffold_9,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_9, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (15%)
          Length = 398

 Score =  299 bits (151), Expect = 2e-81
 Identities = 151/151 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgactacaaaagagaatatcaattgggacgagaccaccatccttgttaagaactatact 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82  atgactacaaaagagaatatcaattgggacgagaccaccatccttgttaagaactatact 141

                                                                       
Query: 61  cttccagatggaagggtcattcaagtagggactgaaaggtttcaggctcctgaggctctt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cttccagatggaagggtcattcaagtagggactgaaaggtttcaggctcctgaggctctt 201

                                          
Query: 121 ttcacaccggaacttatagatagatgttgaa 151
           |||||||||||||||||||||||||||||||
Sbjct: 202 ttcacaccggaacttatagatagatgttgaa 232


>gnl|LJGI|TC58542 homologue to UniRef100_A7P9Y2 Cluster: Chromosome chr14 scaffold_9,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_9, whole genome shotgun
           sequence - Vitis vinifera (Grape), complete
          Length = 1592

 Score =  206 bits (104), Expect = 3e-53
 Identities = 134/143 (93%), Gaps = 2/143 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgactacaaaagagaatatcaattgggac--gagaccaccatccttgttaagaactata 58
           |||||||||| || ||||||||||||||||  ||||||||||||||||||||||||||||
Sbjct: 713 atgactacaagagggaatatcaattgggacttgagaccaccatccttgttaagaactata 772

                                                                       
Query: 59  ctcttccagatggaagggtcattcaagtagggactgaaaggtttcaggctcctgaggctc 118
           |||||||||||||||||||| || ||||||||||||| ||||| ||||| ||||||||||
Sbjct: 773 ctcttccagatggaagggtcgttaaagtagggactgagaggttccaggcccctgaggctc 832

                                  
Query: 119 ttttcacaccggaacttatagat 141
           |||||||||||||||||||||||
Sbjct: 833 ttttcacaccggaacttatagat 855