Miyakogusa Predicted Gene

Lj0g3v0195349.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0195349.1 CUFF.12347.1
         (465 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64934 similar to UniRef100_P34091 Cluster: 60S riboso...   109   2e-23
gnl|LJGI|BP035660 similar to UniRef100_Q674Q4 Cluster: NADH dehy...   107   6e-23
gnl|LJGI|BP042006 similar to UniRef100_A7SNK5 Cluster: Predicted...    54   8e-07

>gnl|LJGI|TC64934 similar to UniRef100_P34091 Cluster: 60S ribosomal protein L6; n=1;
           Mesembryanthemum crystallinum|Rep: 60S ribosomal protein
           L6 - Mesembryanthemum crystallinum (Common ice plant),
           partial (21%)
          Length = 674

 Score =  109 bits (55), Expect = 2e-23
 Identities = 58/59 (98%)
 Strand = Plus / Minus

                                                                      
Query: 407 ttttacttattttaaccgctatgcggttaccgctatttgcccgcgacgctatccgctaa 465
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 105 ttttacttattttaaccgctatgcggataccgctatttgcccgcgacgctatccgctaa 47


>gnl|LJGI|BP035660 similar to UniRef100_Q674Q4 Cluster: NADH dehydrogenase subunit 6;
           n=1; Bemisia tabaci|Rep: NADH dehydrogenase subunit 6 -
           Bemisia tabaci (Sweetpotato whitefly), partial (11%)
          Length = 480

 Score =  107 bits (54), Expect = 6e-23
 Identities = 63/66 (95%)
 Strand = Plus / Plus

                                                                       
Query: 400 tataatattttacttattttaaccgctatgcggttaccgctatttgcccgcgacgctatc 459
           |||||||||||||||||||||||||||||| |||||||||||||||| || |||||||||
Sbjct: 351 tataatattttacttattttaaccgctatgtggttaccgctatttgctcgtgacgctatc 410

                 
Query: 460 cgctaa 465
           ||||||
Sbjct: 411 cgctaa 416


>gnl|LJGI|BP042006 similar to UniRef100_A7SNK5 Cluster: Predicted protein; n=1;
           Nematostella vectensis|Rep: Predicted protein -
           Nematostella vectensis (Starlet sea anemone), partial
           (5%)
          Length = 469

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 435 accgctatttgcccgcgacgctatccgctaa 465
           ||||||||||||| |||||||||||||||||
Sbjct: 352 accgctatttgcctgcgacgctatccgctaa 382