Miyakogusa Predicted Gene

Lj0g3v0192809.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0192809.1 Non Chatacterized Hit- tr|G7IU59|G7IU59_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,37.97,0.000002,
,gene.g14950.t1.1
         (1375 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Ea...   803   0.0  
gnl|LJGI|TC70398 similar to UniRef100_Q47TA8 Cluster: Phosphate:...   190   2e-47
gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL...   159   6e-38
gnl|LJGI|TC74530 similar to UniRef100_Q0DSN5 Cluster: Os03g02977...   109   5e-23
gnl|LJGI|FS340012                                                     101   1e-20
gnl|LJGI|TC73005                                                      101   1e-20
gnl|LJGI|TC70517 similar to UniRef100_Q4T357 Cluster: Chromosome...    68   2e-10
gnl|LJGI|BW599624 similar to UniRef100_A8ZSC6 Cluster: TonB-depe...    56   6e-07

>gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Early growth response
           protein 1; n=2; Mus musculus|Rep: Early growth response
           protein 1 - Mus musculus (Mouse), partial (4%)
          Length = 479

 Score =  803 bits (405), Expect = 0.0
 Identities = 405/405 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75  atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 134

                                                                       
Query: 61  tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgact 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgact 194

                                                                       
Query: 121 ggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaaggcaacatggtgg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 195 ggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaaggcaacatggtgg 254

                                                                       
Query: 181 gaatttgtggaggctctgttgaggaaattcgaaccagaattggaaccgtacatgccagaa 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 255 gaatttgtggaggctctgttgaggaaattcgaaccagaattggaaccgtacatgccagaa 314

                                                                       
Query: 241 ccagtccaagattcagaggaggaagaaatccctgggaagcaagaagtcttggaggcagaa 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 ccagtccaagattcagaggaggaagaaatccctgggaagcaagaagtcttggaggcagaa 374

                                                                       
Query: 301 cgaagaactgttgtggtggaagccaaacctgaggccaattcagtgctgttggcgaaatca 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 375 cgaagaactgttgtggtggaagccaaacctgaggccaattcagtgctgttggcgaaatca 434

                                                        
Query: 361 gagatcaagccatattcgccggagaattctgagatggaagcgtcg 405
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 435 gagatcaagccatattcgccggagaattctgagatggaagcgtcg 479


>gnl|LJGI|TC70398 similar to UniRef100_Q47TA8 Cluster: Phosphate:acyl-[acyl carrier
           protein] acyltransferase; n=1; Thermobifida fusca
           YX|Rep: Phosphate:acyl-[acyl carrier protein]
           acyltransferase - Thermobifida fusca (strain YX),
           partial (5%)
          Length = 825

 Score =  190 bits (96), Expect = 2e-47
 Identities = 215/254 (84%), Gaps = 3/254 (1%)
 Strand = Plus / Minus

                                                                       
Query: 443 cagcggaggtgtcacggtgtcaaccggtcaccgtggttgattacatcgattgcacgttga 502
           |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 779 cagcggtggtgtcacggtgtcaaccggtcaccgtggtcgatttcatcgattgcacgttga 720

                                                                       
Query: 503 cggcgaaaggggagaagatcgacgccgaaggggaaatcaaaatcaag---cggttacagg 559
           |||||||||||||||||||||||||||| ||| |||||   ||||||    |||| ||||
Sbjct: 719 cggcgaaaggggagaagatcgacgccgaggggaaaatcttcatcaagtcttggttgcagg 660

                                                                       
Query: 560 aaggttcttcaatggagaaatggcagatttgcagcattcatgggaggaagaaggtgcaac 619
           ||||| |  ||| |||||||  ||||| | ||| | |||| |||||||||| |||  || 
Sbjct: 659 aaggtgcgacaagggagaaaatgcagactcgcaaccttcaagggaggaagagggttgaat 600

                                                                       
Query: 620 caatcgttttgccccaaatcagtgatttaggattcgattgggagagacggccgccgcgga 679
           ||| |||||| |||||||| | ||| ||||| ||||||||| ||||| ||| ||||||||
Sbjct: 599 caaccgttttcccccaaattactgaattagggttcgattggaagagaaggcagccgcgga 540

                         
Query: 680 aaccgccggattca 693
           |||| || ||||||
Sbjct: 539 aaccacctgattca 526



 Score =  115 bits (58), Expect = 8e-25
 Identities = 139/166 (83%)
 Strand = Plus / Minus

                                                                       
Query: 707 cggtaaccgccaatcgactgccggacacgttcttttgctggacggaggtcttcattcaga 766
           |||||||| ||||| ||| |||||| | |||||||||||| |||| ||||| || |||||
Sbjct: 359 cggtaacccccaattgaccgccggaaaggttcttttgctgcacggtggtctccaatcaga 300

                                                                       
Query: 767 cctctgttctttgctcttcgatggttgccattcaactggagactaagccaccagaccgca 826
           |||| ||||| | ||| |||||||||||||  | |||||||||| || | ||||||||||
Sbjct: 299 cctcagttctgtactcgtcgatggttgccaaccgactggagactgagtcgccagaccgca 240

                                                         
Query: 827 gtggtggcagctcacacttcatccttggcgattcttgcagatcgga 872
           |||||||  | |||| |||||||||||  |||||||| | ||||||
Sbjct: 239 gtggtggtggttcacgcttcatccttgatgattcttgaaaatcgga 194



 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 978  ctcgctcattcgcaagtcggtaaccgtttcacggccgccggcgaagccaccggactttgc 1037
            |||||||||| ||||| |||||||||    ||||||| |||||||||||||||| |||||
Sbjct: 112  ctcgctcatttgcaagccggtaaccgcccaacggccgtcggcgaagccaccggaatttgc 53

                       
Query: 1038 agttatggcgg 1048
            ||||| |||||
Sbjct: 52   agttacggcgg 42


>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
           Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
           (Yeast) (Eremothecium gossypii), partial (8%)
          Length = 691

 Score =  159 bits (80), Expect = 6e-38
 Identities = 197/236 (83%)
 Strand = Plus / Minus

                                                                       
Query: 34  ggatggctcattatggtggagcaacactgtgaggccaagggagtatccgaagaggagaaa 93
           |||||| |||| | ||||||||||||||||||||| || |||||||| |||||| |||||
Sbjct: 674 ggatgggtcatcacggtggagcaacactgtgaggctaaaggagtatctgaagagaagaaa 615

                                                                       
Query: 94  ttctcaggggcagagaaggctttgactggtgaagctttcatgtggtggttttgctggaga 153
           ||||||| |||||||||||  |||||  |||| || ||| | ||||||| || ||||| |
Sbjct: 614 ttctcagaggcagagaaggtgttgacgcgtgatgcgttcttttggtggtattcctggaaa 555

                                                                       
Query: 154 agacgcaatcagaaggcaacatggtgggaatttgtggaggctctgttgaggaaattcgaa 213
           | ||| ||||||| ||||| ||||||||| ||||||   ||  || ||||| ||||||||
Sbjct: 554 aaacgaaatcagagggcaaaatggtgggattttgtgatagcattgctgagggaattcgaa 495

                                                                   
Query: 214 ccagaattggaaccgtacatgccagaaccagtccaagattcagaggaggaagaaat 269
           ||||||| ||||| |||  ||||||| |||||  ||||||||| ||||||||||||
Sbjct: 494 ccagaatcggaactgtatctgccagatccagttgaagattcaggggaggaagaaat 439


>gnl|LJGI|TC74530 similar to UniRef100_Q0DSN5 Cluster: Os03g0297700 protein; n=1;
           Oryza sativa Japonica Group|Rep: Os03g0297700 protein -
           Oryza sativa subsp. japonica (Rice), partial (21%)
          Length = 749

 Score =  109 bits (55), Expect = 5e-23
 Identities = 103/119 (86%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
           ||||||||||| |||||||| |||  ||| || |||||| |||| |  | ||||||||||
Sbjct: 721 atgtttccagagtttgatgggagatgggcttatggatggatcatcacaggggagcaacac 662

                                                                      
Query: 61  tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgac 119
           ||||||||||| ||||||||||||||| |||||||||||| ||||| |||||| |||||
Sbjct: 661 tgtgaggccaaaggagtatccgaagagaagaaattctcagaggcagcgaaggcgttgac 603


>gnl|LJGI|FS340012 
          Length = 685

 Score =  101 bits (51), Expect = 1e-20
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
           ||||||||||||||||||||||||| ||| || |||||| |||| |  || |||||  ||
Sbjct: 283 atgtttccagaatttgatggaagagtggcttatggatggatcatcaccgtagagcagtac 342

                                                                      
Query: 61  tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgac 119
           ||||||||||||||| |||| || ||| |||||||||||| ||| |||||||| |||||
Sbjct: 343 tgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaaggcattgac 401


>gnl|LJGI|TC73005 
          Length = 812

 Score =  101 bits (51), Expect = 1e-20
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
           ||||||||||||||||||||||||| ||| || |||||| |||| |  || |||||  ||
Sbjct: 196 atgtttccagaatttgatggaagagtggcttatggatggatcatcaccgtagagcagtac 137

                                                                      
Query: 61  tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgac 119
           ||||||||||||||| |||| || ||| |||||||||||| ||| |||||||| |||||
Sbjct: 136 tgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaaggcattgac 78


>gnl|LJGI|TC70517 similar to UniRef100_Q4T357 Cluster: Chromosome undetermined
            SCAF10117, whole genome shotgun sequence; n=1; Tetraodon
            nigroviridis|Rep: Chromosome undetermined SCAF10117,
            whole genome shotgun sequence - Tetraodon nigroviridis
            (Green puffer), partial (3%)
          Length = 550

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                              
Query: 1336 cccaccttgaggacaaggtggatgtttagggggg 1369
            ||||||||||||||||||||||||||||||||||
Sbjct: 501  cccaccttgaggacaaggtggatgtttagggggg 468


>gnl|LJGI|BW599624 similar to UniRef100_A8ZSC6 Cluster: TonB-dependent receptor plug;
           n=1; Desulfococcus oleovorans Hxd3|Rep: TonB-dependent,
           partial (2%)
          Length = 515

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 59/68 (86%), Gaps = 1/68 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaac-a 59
           |||||||||||||||||||| |||  ||| || |||||| |||| | ||||||||||| |
Sbjct: 250 atgtttccagaatttgatgggagatgggcttatggatgggtcatcacggtggagcaacta 191

                   
Query: 60  ctgtgagg 67
           ||||||||
Sbjct: 190 ctgtgagg 183