Miyakogusa Predicted Gene
- Lj0g3v0192809.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0192809.1 Non Chatacterized Hit- tr|G7IU59|G7IU59_MEDTR
Putative uncharacterized protein OS=Medicago truncatul,37.97,0.000002,
,gene.g14950.t1.1
(1375 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Ea... 803 0.0
gnl|LJGI|TC70398 similar to UniRef100_Q47TA8 Cluster: Phosphate:... 190 2e-47
gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL... 159 6e-38
gnl|LJGI|TC74530 similar to UniRef100_Q0DSN5 Cluster: Os03g02977... 109 5e-23
gnl|LJGI|FS340012 101 1e-20
gnl|LJGI|TC73005 101 1e-20
gnl|LJGI|TC70517 similar to UniRef100_Q4T357 Cluster: Chromosome... 68 2e-10
gnl|LJGI|BW599624 similar to UniRef100_A8ZSC6 Cluster: TonB-depe... 56 6e-07
>gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Early growth response
protein 1; n=2; Mus musculus|Rep: Early growth response
protein 1 - Mus musculus (Mouse), partial (4%)
Length = 479
Score = 803 bits (405), Expect = 0.0
Identities = 405/405 (100%)
Strand = Plus / Plus
Query: 1 atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75 atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 134
Query: 61 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgact 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgact 194
Query: 121 ggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaaggcaacatggtgg 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 195 ggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaaggcaacatggtgg 254
Query: 181 gaatttgtggaggctctgttgaggaaattcgaaccagaattggaaccgtacatgccagaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 255 gaatttgtggaggctctgttgaggaaattcgaaccagaattggaaccgtacatgccagaa 314
Query: 241 ccagtccaagattcagaggaggaagaaatccctgggaagcaagaagtcttggaggcagaa 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 ccagtccaagattcagaggaggaagaaatccctgggaagcaagaagtcttggaggcagaa 374
Query: 301 cgaagaactgttgtggtggaagccaaacctgaggccaattcagtgctgttggcgaaatca 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 375 cgaagaactgttgtggtggaagccaaacctgaggccaattcagtgctgttggcgaaatca 434
Query: 361 gagatcaagccatattcgccggagaattctgagatggaagcgtcg 405
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 435 gagatcaagccatattcgccggagaattctgagatggaagcgtcg 479
>gnl|LJGI|TC70398 similar to UniRef100_Q47TA8 Cluster: Phosphate:acyl-[acyl carrier
protein] acyltransferase; n=1; Thermobifida fusca
YX|Rep: Phosphate:acyl-[acyl carrier protein]
acyltransferase - Thermobifida fusca (strain YX),
partial (5%)
Length = 825
Score = 190 bits (96), Expect = 2e-47
Identities = 215/254 (84%), Gaps = 3/254 (1%)
Strand = Plus / Minus
Query: 443 cagcggaggtgtcacggtgtcaaccggtcaccgtggttgattacatcgattgcacgttga 502
|||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 779 cagcggtggtgtcacggtgtcaaccggtcaccgtggtcgatttcatcgattgcacgttga 720
Query: 503 cggcgaaaggggagaagatcgacgccgaaggggaaatcaaaatcaag---cggttacagg 559
|||||||||||||||||||||||||||| ||| ||||| |||||| |||| ||||
Sbjct: 719 cggcgaaaggggagaagatcgacgccgaggggaaaatcttcatcaagtcttggttgcagg 660
Query: 560 aaggttcttcaatggagaaatggcagatttgcagcattcatgggaggaagaaggtgcaac 619
||||| | ||| ||||||| ||||| | ||| | |||| |||||||||| ||| ||
Sbjct: 659 aaggtgcgacaagggagaaaatgcagactcgcaaccttcaagggaggaagagggttgaat 600
Query: 620 caatcgttttgccccaaatcagtgatttaggattcgattgggagagacggccgccgcgga 679
||| |||||| |||||||| | ||| ||||| ||||||||| ||||| ||| ||||||||
Sbjct: 599 caaccgttttcccccaaattactgaattagggttcgattggaagagaaggcagccgcgga 540
Query: 680 aaccgccggattca 693
|||| || ||||||
Sbjct: 539 aaccacctgattca 526
Score = 115 bits (58), Expect = 8e-25
Identities = 139/166 (83%)
Strand = Plus / Minus
Query: 707 cggtaaccgccaatcgactgccggacacgttcttttgctggacggaggtcttcattcaga 766
|||||||| ||||| ||| |||||| | |||||||||||| |||| ||||| || |||||
Sbjct: 359 cggtaacccccaattgaccgccggaaaggttcttttgctgcacggtggtctccaatcaga 300
Query: 767 cctctgttctttgctcttcgatggttgccattcaactggagactaagccaccagaccgca 826
|||| ||||| | ||| ||||||||||||| | |||||||||| || | ||||||||||
Sbjct: 299 cctcagttctgtactcgtcgatggttgccaaccgactggagactgagtcgccagaccgca 240
Query: 827 gtggtggcagctcacacttcatccttggcgattcttgcagatcgga 872
||||||| | |||| ||||||||||| |||||||| | ||||||
Sbjct: 239 gtggtggtggttcacgcttcatccttgatgattcttgaaaatcgga 194
Score = 69.9 bits (35), Expect = 4e-11
Identities = 62/71 (87%)
Strand = Plus / Minus
Query: 978 ctcgctcattcgcaagtcggtaaccgtttcacggccgccggcgaagccaccggactttgc 1037
|||||||||| ||||| ||||||||| ||||||| |||||||||||||||| |||||
Sbjct: 112 ctcgctcatttgcaagccggtaaccgcccaacggccgtcggcgaagccaccggaatttgc 53
Query: 1038 agttatggcgg 1048
||||| |||||
Sbjct: 52 agttacggcgg 42
>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
(Yeast) (Eremothecium gossypii), partial (8%)
Length = 691
Score = 159 bits (80), Expect = 6e-38
Identities = 197/236 (83%)
Strand = Plus / Minus
Query: 34 ggatggctcattatggtggagcaacactgtgaggccaagggagtatccgaagaggagaaa 93
|||||| |||| | ||||||||||||||||||||| || |||||||| |||||| |||||
Sbjct: 674 ggatgggtcatcacggtggagcaacactgtgaggctaaaggagtatctgaagagaagaaa 615
Query: 94 ttctcaggggcagagaaggctttgactggtgaagctttcatgtggtggttttgctggaga 153
||||||| ||||||||||| ||||| |||| || ||| | ||||||| || ||||| |
Sbjct: 614 ttctcagaggcagagaaggtgttgacgcgtgatgcgttcttttggtggtattcctggaaa 555
Query: 154 agacgcaatcagaaggcaacatggtgggaatttgtggaggctctgttgaggaaattcgaa 213
| ||| ||||||| ||||| ||||||||| |||||| || || ||||| ||||||||
Sbjct: 554 aaacgaaatcagagggcaaaatggtgggattttgtgatagcattgctgagggaattcgaa 495
Query: 214 ccagaattggaaccgtacatgccagaaccagtccaagattcagaggaggaagaaat 269
||||||| ||||| ||| ||||||| ||||| ||||||||| ||||||||||||
Sbjct: 494 ccagaatcggaactgtatctgccagatccagttgaagattcaggggaggaagaaat 439
>gnl|LJGI|TC74530 similar to UniRef100_Q0DSN5 Cluster: Os03g0297700 protein; n=1;
Oryza sativa Japonica Group|Rep: Os03g0297700 protein -
Oryza sativa subsp. japonica (Rice), partial (21%)
Length = 749
Score = 109 bits (55), Expect = 5e-23
Identities = 103/119 (86%)
Strand = Plus / Minus
Query: 1 atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
||||||||||| |||||||| ||| ||| || |||||| |||| | | ||||||||||
Sbjct: 721 atgtttccagagtttgatgggagatgggcttatggatggatcatcacaggggagcaacac 662
Query: 61 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgac 119
||||||||||| ||||||||||||||| |||||||||||| ||||| |||||| |||||
Sbjct: 661 tgtgaggccaaaggagtatccgaagagaagaaattctcagaggcagcgaaggcgttgac 603
>gnl|LJGI|FS340012
Length = 685
Score = 101 bits (51), Expect = 1e-20
Identities = 102/119 (85%)
Strand = Plus / Plus
Query: 1 atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
||||||||||||||||||||||||| ||| || |||||| |||| | || ||||| ||
Sbjct: 283 atgtttccagaatttgatggaagagtggcttatggatggatcatcaccgtagagcagtac 342
Query: 61 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgac 119
||||||||||||||| |||| || ||| |||||||||||| ||| |||||||| |||||
Sbjct: 343 tgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaaggcattgac 401
>gnl|LJGI|TC73005
Length = 812
Score = 101 bits (51), Expect = 1e-20
Identities = 102/119 (85%)
Strand = Plus / Minus
Query: 1 atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 60
||||||||||||||||||||||||| ||| || |||||| |||| | || ||||| ||
Sbjct: 196 atgtttccagaatttgatggaagagtggcttatggatggatcatcaccgtagagcagtac 137
Query: 61 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgac 119
||||||||||||||| |||| || ||| |||||||||||| ||| |||||||| |||||
Sbjct: 136 tgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaaggcattgac 78
>gnl|LJGI|TC70517 similar to UniRef100_Q4T357 Cluster: Chromosome undetermined
SCAF10117, whole genome shotgun sequence; n=1; Tetraodon
nigroviridis|Rep: Chromosome undetermined SCAF10117,
whole genome shotgun sequence - Tetraodon nigroviridis
(Green puffer), partial (3%)
Length = 550
Score = 67.9 bits (34), Expect = 2e-10
Identities = 34/34 (100%)
Strand = Plus / Minus
Query: 1336 cccaccttgaggacaaggtggatgtttagggggg 1369
||||||||||||||||||||||||||||||||||
Sbjct: 501 cccaccttgaggacaaggtggatgtttagggggg 468
>gnl|LJGI|BW599624 similar to UniRef100_A8ZSC6 Cluster: TonB-dependent receptor plug;
n=1; Desulfococcus oleovorans Hxd3|Rep: TonB-dependent,
partial (2%)
Length = 515
Score = 56.0 bits (28), Expect = 6e-07
Identities = 59/68 (86%), Gaps = 1/68 (1%)
Strand = Plus / Minus
Query: 1 atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaac-a 59
|||||||||||||||||||| ||| ||| || |||||| |||| | ||||||||||| |
Sbjct: 250 atgtttccagaatttgatgggagatgggcttatggatgggtcatcacggtggagcaacta 191
Query: 60 ctgtgagg 67
||||||||
Sbjct: 190 ctgtgagg 183