Miyakogusa Predicted Gene

Lj0g3v0191599.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0191599.1 Non Chatacterized Hit- tr|C5WVI2|C5WVI2_SORBI
Putative uncharacterized protein Sb01g031577
(Fragment,34.27,0.000000000000002,seg,NULL,CUFF.12124.1
         (1101 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|CN825416 similar to UniRef100_Q9FZI9 Cluster: F17L21.26...    96   6e-19

>gnl|LJGI|CN825416 similar to UniRef100_Q9FZI9 Cluster: F17L21.26; n=1; Arabidopsis
           thaliana|Rep: F17L21.26 - Arabidopsis thaliana
           (Mouse-ear cress), partial (9%)
          Length = 585

 Score = 95.6 bits (48), Expect = 6e-19
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 697 gaggaagaggttgaatctgaggcattaccagctgttatatcagattccaaaaacagagtg 756
           ||||| |||||||| |||||| | ||||| |||||||||||||| || || |||||||| 
Sbjct: 442 gaggatgaggttgagtctgagtctttacctgctgttatatcagactcaaataacagagtt 383

                                                                       
Query: 757 agggtggcaaattctgcatacaaagagatggtgggtcagccagaatgtccttggcttgag 816
           ||| |||| || ||||| || || |||||||||||||||||| ||||| | |||||  ||
Sbjct: 382 aggatggctaactctgcttataaggagatggtgggtcagccacaatgttcatggctcaag 323

                   
Query: 817 tccatggt 824
           ||||||||
Sbjct: 322 tccatggt 315



 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 901 ccaatttcatcaaatgggttctcttgctgggtgaggat 938
           ||||||||||||||||| || |||||||||||||||||
Sbjct: 256 ccaatttcatcaaatggattttcttgctgggtgaggat 219