Miyakogusa Predicted Gene

Lj0g3v0191479.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0191479.1 tr|B4MIF7|B4MIF7_DROWI GK20609 OS=Drosophila
willistoni GN=GK20609 PE=4 SV=1,36.59,2.4, ,CUFF.12118.1
         (265 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61974 similar to UniRef100_Q6H6D3 Cluster: Peptidyl-p...    76   1e-13
gnl|LJGI|AV766436                                                      56   1e-07
gnl|LJGI|BP048724 homologue to UniRef100_A7P2R5 Cluster: Peptidy...    52   2e-06

>gnl|LJGI|TC61974 similar to UniRef100_Q6H6D3 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Oryza sativa Japonica Group|Rep:
           Peptidyl-prolyl cis-trans isomerase - Oryza sativa
           subsp. japonica (Rice), partial (73%)
          Length = 793

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 38/38 (100%)
 Strand = Plus / Minus

                                                 
Query: 228 attaggtgggatgggctcctgtgatgtgttctggtagc 265
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 477 attaggtgggatgggctcctgtgatgtgttctggtagc 440


>gnl|LJGI|AV766436 
          Length = 363

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 13  atgtgttgtttttccgttttcatactttctaa 44
           ||||||| ||||||||||||||||||||||||
Sbjct: 309 atgtgttatttttccgttttcatactttctaa 340


>gnl|LJGI|BP048724 homologue to UniRef100_A7P2R5 Cluster: Peptidyl-prolyl cis-trans
           isomerase; n=1; Vitis vinifera|Rep: Peptidyl-prolyl
           cis-trans isomerase - Vitis vinifera (Grape), partial
           (18%)
          Length = 513

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 91  aataaattcaacaaaatgtgtcttgacatg 120
           ||||||||||||||||||||||| ||||||
Sbjct: 484 aataaattcaacaaaatgtgtctcgacatg 513