Miyakogusa Predicted Gene

Lj0g3v0183649.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0183649.1 CUFF.11629.1
         (616 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75314 similar to UniRef100_Q0DEL4 Cluster: Os06g01465...    66   3e-10
gnl|LJGI|TC74357 similar to UniRef100_Q6CA16 Cluster: Similarity...    66   3e-10
gnl|LJGI|TC59377 similar to UniRef100_Q9SET1 Cluster: Cell wall-...    66   3e-10
gnl|LJGI|TC75406                                                       62   4e-09
gnl|LJGI|AV766686 similar to UniRef100_Q95US3 Cluster: Pairberry...    54   1e-06
gnl|LJGI|TC79302                                                       52   4e-06

>gnl|LJGI|TC75314 similar to UniRef100_Q0DEL4 Cluster: Os06g0146500 protein; n=1;
           Oryza sativa Japonica Group|Rep: Os06g0146500 protein -
           Oryza sativa subsp. japonica (Rice), partial (13%)
          Length = 775

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 434 gtggttcatgtggtgcgtccatgatggggttgtgggtggcc 474
           ||||||||||| ||||||||||||||| |||||||||||||
Sbjct: 433 gtggttcatgtcgtgcgtccatgatggtgttgtgggtggcc 393


>gnl|LJGI|TC74357 similar to UniRef100_Q6CA16 Cluster: Similarity; n=1; Yarrowia
           lipolytica|Rep: Similarity - Yarrowia lipolytica
           (Candida lipolytica), partial (12%)
          Length = 781

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 434 gtggttcatgtggtgcgtccatgatggggttgtgggtggcc 474
           ||||||||||| ||||||||||||||| |||||||||||||
Sbjct: 477 gtggttcatgtcgtgcgtccatgatggtgttgtgggtggcc 437


>gnl|LJGI|TC59377 similar to UniRef100_Q9SET1 Cluster: Cell wall-plasma membrane
           linker protein homolog; n=1; Arabidopsis thaliana|Rep:
           Cell wall-plasma membrane linker protein homolog -
           Arabidopsis thaliana (Mouse-ear cress), partial (7%)
          Length = 2110

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 434 gtggttcatgtggtgcgtccatgatggggttgtgggtggcc 474
           ||||||||||| ||||||||||||||| |||||||||||||
Sbjct: 465 gtggttcatgtcgtgcgtccatgatggtgttgtgggtggcc 425


>gnl|LJGI|TC75406 
          Length = 699

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 366 tgaagagcttgtggccgtccatggtgattgt 396
           |||||||||||||||||||||||||||||||
Sbjct: 229 tgaagagcttgtggccgtccatggtgattgt 199


>gnl|LJGI|AV766686 similar to UniRef100_Q95US3 Cluster: Pairberry 1 transcription
           factor; n=1; Schistocerca americana|Rep: Pairberry 1
           transcription factor - Schistocerca americana (American
           grasshopper), partial (7%)
          Length = 536

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 2   tgaacggaggtccgatgacaccggaatcaaaggtc 36
           |||||||||| ||||||||||||||||| ||||||
Sbjct: 461 tgaacggaggcccgatgacaccggaatcgaaggtc 495


>gnl|LJGI|TC79302 
          Length = 1713

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 2   tgaacggaggtccgatgacaccggaatcaaaggtcgaagattgcggcgtcggcg 55
           ||||| |||| |||| |||| || |||| |||| ||||||||||||||||||||
Sbjct: 576 tgaaccgaggcccgaggacaacgaaatcgaagggcgaagattgcggcgtcggcg 523