Miyakogusa Predicted Gene
- Lj0g3v0183649.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0183649.1 CUFF.11629.1
(616 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75314 similar to UniRef100_Q0DEL4 Cluster: Os06g01465... 66 3e-10
gnl|LJGI|TC74357 similar to UniRef100_Q6CA16 Cluster: Similarity... 66 3e-10
gnl|LJGI|TC59377 similar to UniRef100_Q9SET1 Cluster: Cell wall-... 66 3e-10
gnl|LJGI|TC75406 62 4e-09
gnl|LJGI|AV766686 similar to UniRef100_Q95US3 Cluster: Pairberry... 54 1e-06
gnl|LJGI|TC79302 52 4e-06
>gnl|LJGI|TC75314 similar to UniRef100_Q0DEL4 Cluster: Os06g0146500 protein; n=1;
Oryza sativa Japonica Group|Rep: Os06g0146500 protein -
Oryza sativa subsp. japonica (Rice), partial (13%)
Length = 775
Score = 65.9 bits (33), Expect = 3e-10
Identities = 39/41 (95%)
Strand = Plus / Minus
Query: 434 gtggttcatgtggtgcgtccatgatggggttgtgggtggcc 474
||||||||||| ||||||||||||||| |||||||||||||
Sbjct: 433 gtggttcatgtcgtgcgtccatgatggtgttgtgggtggcc 393
>gnl|LJGI|TC74357 similar to UniRef100_Q6CA16 Cluster: Similarity; n=1; Yarrowia
lipolytica|Rep: Similarity - Yarrowia lipolytica
(Candida lipolytica), partial (12%)
Length = 781
Score = 65.9 bits (33), Expect = 3e-10
Identities = 39/41 (95%)
Strand = Plus / Minus
Query: 434 gtggttcatgtggtgcgtccatgatggggttgtgggtggcc 474
||||||||||| ||||||||||||||| |||||||||||||
Sbjct: 477 gtggttcatgtcgtgcgtccatgatggtgttgtgggtggcc 437
>gnl|LJGI|TC59377 similar to UniRef100_Q9SET1 Cluster: Cell wall-plasma membrane
linker protein homolog; n=1; Arabidopsis thaliana|Rep:
Cell wall-plasma membrane linker protein homolog -
Arabidopsis thaliana (Mouse-ear cress), partial (7%)
Length = 2110
Score = 65.9 bits (33), Expect = 3e-10
Identities = 39/41 (95%)
Strand = Plus / Minus
Query: 434 gtggttcatgtggtgcgtccatgatggggttgtgggtggcc 474
||||||||||| ||||||||||||||| |||||||||||||
Sbjct: 465 gtggttcatgtcgtgcgtccatgatggtgttgtgggtggcc 425
>gnl|LJGI|TC75406
Length = 699
Score = 61.9 bits (31), Expect = 4e-09
Identities = 31/31 (100%)
Strand = Plus / Minus
Query: 366 tgaagagcttgtggccgtccatggtgattgt 396
|||||||||||||||||||||||||||||||
Sbjct: 229 tgaagagcttgtggccgtccatggtgattgt 199
>gnl|LJGI|AV766686 similar to UniRef100_Q95US3 Cluster: Pairberry 1 transcription
factor; n=1; Schistocerca americana|Rep: Pairberry 1
transcription factor - Schistocerca americana (American
grasshopper), partial (7%)
Length = 536
Score = 54.0 bits (27), Expect = 1e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 2 tgaacggaggtccgatgacaccggaatcaaaggtc 36
|||||||||| ||||||||||||||||| ||||||
Sbjct: 461 tgaacggaggcccgatgacaccggaatcgaaggtc 495
>gnl|LJGI|TC79302
Length = 1713
Score = 52.0 bits (26), Expect = 4e-06
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 2 tgaacggaggtccgatgacaccggaatcaaaggtcgaagattgcggcgtcggcg 55
||||| |||| |||| |||| || |||| |||| ||||||||||||||||||||
Sbjct: 576 tgaaccgaggcccgaggacaacgaaatcgaagggcgaagattgcggcgtcggcg 523