Miyakogusa Predicted Gene

Lj0g3v0183609.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0183609.1 Non Chatacterized Hit- tr|I1KW21|I1KW21_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.27032
PE,75.17,0,cAMP-binding domain-like,Cyclic nucleotide-binding-like;
Voltage-gated potassium channels,NULL; no d,CUFF.11643.1
         (2211 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65833 homologue to UniRef100_A7QWI8 Cluster: Chromoso...    64   4e-09

>gnl|LJGI|TC65833 homologue to UniRef100_A7QWI8 Cluster: Chromosome chr10 scaffold_204,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr10 scaffold_204, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (36%)
          Length = 1212

 Score = 63.9 bits (32), Expect = 4e-09
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2113 aatgcagagaatgcagagatagacgatatgagtgtcagtcgagacggtgagcatctcttt 2172
            ||| ||||||||||||||||||| || || | ||| | | |||| ||||| |||||||||
Sbjct: 1194 aatncagagaatgcagagatagatgacattaatgtgattagagatggtgatcatctcttt 1135

                                           
Query: 2173 ttgcttagcagtgacagtgaaattttgagtt 2203
             | ||| |||| |||||||||| ||||||||
Sbjct: 1134 cttctttgcagcgacagtgaaaatttgagtt 1104