Miyakogusa Predicted Gene
- Lj0g3v0182149.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0182149.1 tr|B8IZ05|B8IZ05_DESDA Glycine betaine/L-proline
ABC transporter, ATPase subunit OS=Desulfovibrio
de,29.51,9.2,seg,NULL; PROKAR_LIPOPROTEIN,NULL,CUFF.11595.1
(319 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64934 similar to UniRef100_P34091 Cluster: 60S riboso... 198 1e-50
gnl|LJGI|BP035660 similar to UniRef100_Q674Q4 Cluster: NADH dehy... 163 8e-40
gnl|LJGI|BP042006 similar to UniRef100_A7SNK5 Cluster: Predicted... 155 2e-37
gnl|LJGI|FS344753 similar to UniRef100_A7QPN4 Cluster: Chromosom... 66 1e-10
gnl|LJGI|BW617461 56 1e-07
>gnl|LJGI|TC64934 similar to UniRef100_P34091 Cluster: 60S ribosomal protein L6; n=1;
Mesembryanthemum crystallinum|Rep: 60S ribosomal protein
L6 - Mesembryanthemum crystallinum (Common ice plant),
partial (21%)
Length = 674
Score = 198 bits (100), Expect = 1e-50
Identities = 100/100 (100%)
Strand = Plus / Minus
Query: 97 acttattttaaccgctatgcggataccgctatttgcccgcgacgctatccgctaaatgaa 156
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 101 acttattttaaccgctatgcggataccgctatttgcccgcgacgctatccgctaaatgaa 42
Query: 157 atagcggattttggcctcgccgcgatattccgcgatcgcg 196
||||||||||||||||||||||||||||||||||||||||
Sbjct: 41 atagcggattttggcctcgccgcgatattccgcgatcgcg 2
>gnl|LJGI|BP035660 similar to UniRef100_Q674Q4 Cluster: NADH dehydrogenase subunit 6;
n=1; Bemisia tabaci|Rep: NADH dehydrogenase subunit 6 -
Bemisia tabaci (Sweetpotato whitefly), partial (11%)
Length = 480
Score = 163 bits (82), Expect = 8e-40
Identities = 106/114 (92%)
Strand = Plus / Plus
Query: 97 acttattttaaccgctatgcggataccgctatttgcccgcgacgctatccgctaaatgaa 156
||||||||||||||||||| || ||||||||||||| || |||||||||||||||| | |
Sbjct: 362 acttattttaaccgctatgtggttaccgctatttgctcgtgacgctatccgctaaacgca 421
Query: 157 atagcggattttggcctcgccgcgatattccgcgatcgcgatttgacaacactg 210
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||
Sbjct: 422 atagcggattttggcctcaccgcgattttccgcgatcgcgatttgacaacactg 475
>gnl|LJGI|BP042006 similar to UniRef100_A7SNK5 Cluster: Predicted protein; n=1;
Nematostella vectensis|Rep: Predicted protein -
Nematostella vectensis (Starlet sea anemone), partial
(5%)
Length = 469
Score = 155 bits (78), Expect = 2e-37
Identities = 87/90 (96%)
Strand = Plus / Plus
Query: 121 accgctatttgcccgcgacgctatccgctaaatgaaatagcggattttggcctcgccgcg 180
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 352 accgctatttgcctgcgacgctatccgctaaatgaagtagcggattttggcctcgccgcg 411
Query: 181 atattccgcgatcgcgatttgacaacactg 210
|||||||||||||||||||||| |||||||
Sbjct: 412 atattccgcgatcgcgatttgataacactg 441
>gnl|LJGI|FS344753 similar to UniRef100_A7QPN4 Cluster: Chromosome chr10 scaffold_138,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr10 scaffold_138, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (16%)
Length = 717
Score = 65.9 bits (33), Expect = 1e-10
Identities = 51/57 (89%)
Strand = Plus / Minus
Query: 154 gaaatagcggattttggcctcgccgcgatattccgcgatcgcgatttgacaacactg 210
||||||||||||||| | ||| ||||||| |||||||||||||||||| |||||||
Sbjct: 685 gaaatagcggatttttggctcaccgcgatggtccgcgatcgcgatttgataacactg 629
>gnl|LJGI|BW617461
Length = 455
Score = 56.0 bits (28), Expect = 1e-07
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 157 atagcggattttggcctcgccgcgatattccgcgatcgcgatttgacaacactggt 212
|||||||||||| | ||| ||||||| |||||||||| ||||||| |||||||||
Sbjct: 284 atagcggatttttggctcaccgcgatggtccgcgatcgtgatttgataacactggt 339