Miyakogusa Predicted Gene

Lj0g3v0178899.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0178899.1 tr|G7LE34|G7LE34_MEDTR Cation proton exchanger
OS=Medicago truncatula GN=MTR_8g093780 PE=4 SV=1,77.92,0,no
description,Rossmann-like alpha/beta/alpha sandwich fold;
Na_H_Exchanger,Cation/H+ exchanger; seg,gene.g13823.t1.1
         (2313 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP033315 similar to UniRef100_Q58P71 Cluster: Cation/H+...    54   4e-06

>gnl|LJGI|BP033315 similar to UniRef100_Q58P71 Cluster: Cation/H+ exchanger; n=2;
            Arabidopsis thaliana|Rep: Cation/H+ exchanger -
            Arabidopsis thaliana (Mouse-ear cress), partial (5%)
          Length = 419

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 2083 tggagtgagtgtccagagttaggagcaattgggga 2117
            |||||||||||||||||||||||  ||||||||||
Sbjct: 272  tggagtgagtgtccagagttagggacaattgggga 238