Miyakogusa Predicted Gene

Lj0g3v0177989.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0177989.1 Non Chatacterized Hit- tr|I1KWY3|I1KWY3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.56608
PE,54.35,0.012,Synthase_beta,ATP synthase, F1 beta subunit;
seg,NULL,CUFF.11250.1
         (210 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64471 similar to UniRef100_A7PCQ9 Cluster: Ribosomal ...   264   2e-70

>gnl|LJGI|TC64471 similar to UniRef100_A7PCQ9 Cluster: Ribosomal protein L19; n=1;
           Vitis vinifera|Rep: Ribosomal protein L19 - Vitis
           vinifera (Grape), partial (90%)
          Length = 1094

 Score =  264 bits (133), Expect = 2e-70
 Identities = 133/133 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcttcacggagactattatcgtctctactccgatcacccctcacccgatctccgccg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 70  atggcttcacggagactattatcgtctctactccgatcacccctcacccgatctccgccg 129

                                                                       
Query: 61  cattttcaatctccgatctcttcccggccattctcctccccgaaactcgcttctcctcct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 130 cattttcaatctccgatctcttcccggccattctcctccccgaaactcgcttctcctcct 189

                        
Query: 121 tctccggccgccg 133
           |||||||||||||
Sbjct: 190 tctccggccgccg 202