Miyakogusa Predicted Gene

Lj0g3v0174579.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0174579.1 Non Chatacterized Hit- tr|D8S2H6|D8S2H6_SELML
Putative uncharacterized protein OS=Selaginella
moelle,40.43,1e-17,seg,NULL,CUFF.10970.1
         (411 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70632 weakly similar to UniRef100_P13983 Cluster: Ext...    96   2e-19
gnl|LJGI|DC598220 weakly similar to UniRef100_P13983 Cluster: Ex...    74   7e-13

>gnl|LJGI|TC70632 weakly similar to UniRef100_P13983 Cluster: Extensin precursor;
           n=1; Nicotiana tabacum|Rep: Extensin precursor -
           Nicotiana tabacum (Common tobacco), partial (6%)
          Length = 987

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                       
Query: 172 gatttcatcacatcggtttcatcttcctcttcctctaatgttgatgttgttgttgatgat 231
           |||||||||||||  ||||| ||||||| ||||| | ||||||||||||  || |||| |
Sbjct: 265 gatttcatcacattcgtttcctcttccttttcctattatgttgatgttgcagtggatgct 324

                                               
Query: 232 cgtgattcttgtgtttccttgcttcatgaaatcgac 267
           |||| |||||||||||||||| ||||||||||||||
Sbjct: 325 cgtggttcttgtgtttccttgtttcatgaaatcgac 360


>gnl|LJGI|DC598220 weakly similar to UniRef100_P13983 Cluster: Extensin precursor;
           n=1; Nicotiana tabacum|Rep: Extensin precursor -
           Nicotiana tabacum (Common tobacco), partial (5%)
          Length = 482

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 193 tcttcctcttcctctaatgttgatgttgttgttgatgatcgtgattcttgtgtttccttg 252
           ||||||||||||| |  |||||||||||  || |||| |  || ||||||||||||||||
Sbjct: 280 tcttcctcttcctattctgttgatgttgcagtggatgcttttggttcttgtgtttccttg 339

                                
Query: 253 cttcatgaaatcgactgggag 273
           ||||||| |||||||||||||
Sbjct: 340 cttcatgcaatcgactgggag 360