Miyakogusa Predicted Gene
- Lj0g3v0174579.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0174579.1 Non Chatacterized Hit- tr|D8S2H6|D8S2H6_SELML
Putative uncharacterized protein OS=Selaginella
moelle,40.43,1e-17,seg,NULL,CUFF.10970.1
(411 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70632 weakly similar to UniRef100_P13983 Cluster: Ext... 96 2e-19
gnl|LJGI|DC598220 weakly similar to UniRef100_P13983 Cluster: Ex... 74 7e-13
>gnl|LJGI|TC70632 weakly similar to UniRef100_P13983 Cluster: Extensin precursor;
n=1; Nicotiana tabacum|Rep: Extensin precursor -
Nicotiana tabacum (Common tobacco), partial (6%)
Length = 987
Score = 95.6 bits (48), Expect = 2e-19
Identities = 84/96 (87%)
Strand = Plus / Plus
Query: 172 gatttcatcacatcggtttcatcttcctcttcctctaatgttgatgttgttgttgatgat 231
||||||||||||| ||||| ||||||| ||||| | |||||||||||| || |||| |
Sbjct: 265 gatttcatcacattcgtttcctcttccttttcctattatgttgatgttgcagtggatgct 324
Query: 232 cgtgattcttgtgtttccttgcttcatgaaatcgac 267
|||| |||||||||||||||| ||||||||||||||
Sbjct: 325 cgtggttcttgtgtttccttgtttcatgaaatcgac 360
>gnl|LJGI|DC598220 weakly similar to UniRef100_P13983 Cluster: Extensin precursor;
n=1; Nicotiana tabacum|Rep: Extensin precursor -
Nicotiana tabacum (Common tobacco), partial (5%)
Length = 482
Score = 73.8 bits (37), Expect = 7e-13
Identities = 70/81 (86%)
Strand = Plus / Plus
Query: 193 tcttcctcttcctctaatgttgatgttgttgttgatgatcgtgattcttgtgtttccttg 252
||||||||||||| | ||||||||||| || |||| | || ||||||||||||||||
Sbjct: 280 tcttcctcttcctattctgttgatgttgcagtggatgcttttggttcttgtgtttccttg 339
Query: 253 cttcatgaaatcgactgggag 273
||||||| |||||||||||||
Sbjct: 340 cttcatgcaatcgactgggag 360