Miyakogusa Predicted Gene

Lj0g3v0169259.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0169259.1 Non Chatacterized Hit- tr|G4DMA7|G4DMA7_9GAMM
Putative uncharacterized protein OS=Thioalkalivibrio t,25.4,2.9,
,CUFF.10625.1
         (243 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP072294 UniRef100_Q7PDU2 Cluster: Arabidopsis thaliana...    52   2e-06
gnl|LJGI|TC79661                                                       52   2e-06

>gnl|LJGI|BP072294 UniRef100_Q7PDU2 Cluster: Arabidopsis thaliana BRAHMA
           ortholog-related; n=1; Plasmodium yoelii yoelii|Rep:,
           partial (0%)
          Length = 455

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 24  gatatcagagaggggaaggatttacggcgcacaaaggggaccacaa 69
           ||||||||||||||||||||  || |||||||| ||| ||||||||
Sbjct: 375 gatatcagagaggggaaggagctatggcgcacagaggtgaccacaa 330


>gnl|LJGI|TC79661 
          Length = 388

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                        
Query: 24 gatatcagagaggggaaggatttacggcgcacaaaggggaccacaa 69
          ||||||||||||||||||||  || |||||||| ||| ||||||||
Sbjct: 10 gatatcagagaggggaaggagctatggcgcacagaggtgaccacaa 55