Miyakogusa Predicted Gene

Lj0g3v0169239.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0169239.1 Non Chatacterized Hit- tr|I1N1T9|I1N1T9_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max PE=3,79.61,0,no
description,NULL; no description,Transketolase-like, C-terminal;
TRANSKETOLASE_2,Transketolase bi,gene.g12997.t1.1
         (1608 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58045 homologue to UniRef100_Q8L692 Cluster: 1-deoxy-...   389   e-107
gnl|LJGI|AV767242 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D...   303   2e-81
gnl|LJGI|TC64910 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-...   242   6e-63
gnl|LJGI|GO020915 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D...   212   5e-54
gnl|LJGI|TC67900 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-...   161   2e-38
gnl|LJGI|TC62963 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-...   147   2e-34

>gnl|LJGI|TC58045 homologue to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose
           5-phosphate synthase 2 precursor; n=1; Medicago
           truncatula|Rep: 1-deoxy-D-xylulose 5-phosphate synthase
           2 precursor - Medicago truncatula (Barrel medic),
           partial (32%)
          Length = 831

 Score =  389 bits (196), Expect = e-107
 Identities = 303/339 (89%), Gaps = 6/339 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcacaccattaagatgacttcagggctagcaggttttcctaaaagggatgagagcatt 60
           |||||||| |||| || ||| |||||||||||||| ||||| ||||||||||||||||||
Sbjct: 490 atgcacacaattaggaagacatcagggctagcaggctttccgaaaagggatgagagcatt 549

                                                                       
Query: 61  catgatgcttttggagtaggacatagttctacaagcatatctgctgg------catggca 114
           |||||||||||||| | |||||| ||||||||||||||||| |||||      |||||||
Sbjct: 550 catgatgcttttggggcaggacacagttctacaagcatatcagctggtcttggcatggca 609

                                                                       
Query: 115 gttgcacgtgatctattggaaaagaagaacaatgtaatttcagtgattggagatggagca 174
           |||||| | |||||||||| ||| || |||| ||||||||||||||||||||||||||||
Sbjct: 610 gttgcaagggatctattgggaaataaaaacagtgtaatttcagtgattggagatggagca 669

                                                                       
Query: 175 atgactgctgggttagcgtatgaggccatcaacaatgcaggattccttgatactaacttg 234
           |||||||| |||   || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 670 atgactgcagggcaggcttatgaggccatgaacaatgcaggattccttgatactaacttg 729

                                                                       
Query: 235 atagttgtacttaatgacaacaagcaagtctctttgccaactgctactctcgacggccct 294
           ||||||||||||||||| |||||||||||||||||||||||||| || || || ||||||
Sbjct: 730 atagttgtacttaatgataacaagcaagtctctttgccaactgcaacacttgatggccct 789

                                                  
Query: 295 gcaactccagttggagcccttagtaggactttaagcaaa 333
           |||||||||||||||||| | ||||| ||||||||||||
Sbjct: 790 gcaactccagttggagccatcagtagtactttaagcaaa 828


>gnl|LJGI|AV767242 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
           synthase 2 precursor; n=1; Medicago truncatula|Rep:
           1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
           Medicago truncatula (Barrel medic), partial (15%)
          Length = 319

 Score =  303 bits (153), Expect = 2e-81
 Identities = 258/293 (88%)
 Strand = Plus / Plus

                                                                       
Query: 434 tcggccccgtggatggtcataacatcgaagatctggtcctcatttttgagaaagtgaaag 493
           ||||||| ||||||||||||||  | |||||| | |||  ||||||||||||||||||||
Sbjct: 27  tcggccctgtggatggtcataatgttgaagatttagtcaccatttttgagaaagtgaaag 86

                                                                       
Query: 494 caatgcctacactaggtcctgttttgattcatgttgtgacagaaaaaggaaagggatacc 553
           ||| |||| | | |||||| |||||||||||| |||||||||||||||| ||||||||||
Sbjct: 87  caacgcctgccccaggtccagttttgattcatattgtgacagaaaaagggaagggatacc 146

                                                                       
Query: 554 cgccagctgaagcagcagctgataaaatgcataatgttgccaagtttgatccaaaaacag 613
           | |||||||||| ||||| |||||||||||||  |||||  ||||||||||||||||| |
Sbjct: 147 ccccagctgaaggagcagatgataaaatgcatggtgttgtgaagtttgatccaaaaacgg 206

                                                                       
Query: 614 gacgccagtttaagccaaaatcgtctacactttcatataaccagtactttgctgaatctc 673
           | |||||||||||||||||| | || ||||||||||| | ||||||||||||||||||| 
Sbjct: 207 gtcgccagtttaagccaaaaccctccacactttcatacacccagtactttgctgaatctt 266

                                                                
Query: 674 tgatcaaggaagctgaaattgacaaaaacatagttgctattcacgcagcaatg 726
           |||| |||||||||||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 267 tgataaaggaagctgaaatcgacaacaagatagtagctattcacgcagcaatg 319


>gnl|LJGI|TC64910 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
            synthase 2 precursor; n=1; Medicago truncatula|Rep:
            1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
            Medicago truncatula (Barrel medic), partial (17%)
          Length = 654

 Score =  242 bits (122), Expect = 6e-63
 Identities = 281/334 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1258 gctgcagaaatgcttaaaacaataggtgtttatgtgacagttgctgatgctaggttctgc 1317
            |||||| |||||||||   |||||||  || |||| || |||||||||||||||||||||
Sbjct: 20   gctgcaaaaatgcttagcgcaataggaattgatgttaccgttgctgatgctaggttctgc 79

                                                                        
Query: 1318 aagccattagatactgatctcattcaactactagctaaagagcatgaagtactcattaca 1377
            || || || ||||||||||||||| | ||||||||||||||||||||| |||| || |||
Sbjct: 80   aaacctttggatactgatctcattaagctactagctaaagagcatgaaatactaatcaca 139

                                                                        
Query: 1378 ttggaagagggttctattggaggttttgcatcccatgtttcacaattcttaagcatatct 1437
             |||| || |||||||||||||| |||| ||| ||||||||||||| ||||||| || ||
Sbjct: 140  gtggaggaaggttctattggaggctttggatcgcatgtttcacaatacttaagcttagct 199

                                                                        
Query: 1438 ggtatccttgatggacctctgaagtggagaccaatgatgcttcctgataaatatattgag 1497
            || ||| | ||||| ||||||||||||||| | ||||||||||||||||  || ||||| 
Sbjct: 200  gggatcttggatggtcctctgaagtggagagcgatgatgcttcctgataggtacattgac 259

                                                                        
Query: 1498 catggatctgcccaatttcagaatgaagaagcaggtctttcctcaaagcatgttgctgct 1557
            ||||||||  |||||  ||||| ||||||||||||||| || ||||||||  |||| || 
Sbjct: 260  catggatcaccccaagatcagactgaagaagcaggtctatcatcaaagcaaattgccgcc 319

                                              
Query: 1558 acagtcttgtctcttataggaagggcaaaagaag 1591
            || ||||||||| |||| | |||  |||||||||
Sbjct: 320  acggtcttgtcttttatggaaagaccaaaagaag 353


>gnl|LJGI|GO020915 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
           synthase 2 precursor; n=1; Medicago truncatula|Rep:
           1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
           Medicago truncatula (Barrel medic), partial (15%)
          Length = 330

 Score =  212 bits (107), Expect = 5e-54
 Identities = 107/107 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcacaccattaagatgacttcagggctagcaggttttcctaaaagggatgagagcatt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200 atgcacaccattaagatgacttcagggctagcaggttttcctaaaagggatgagagcatt 259

                                                          
Query: 61  catgatgcttttggagtaggacatagttctacaagcatatctgctgg 107
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 catgatgcttttggagtaggacatagttctacaagcatatctgctgg 306


>gnl|LJGI|TC67900 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
           synthase 2 precursor; n=1; Medicago truncatula|Rep:
           1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
           Medicago truncatula (Barrel medic), partial (32%)
          Length = 824

 Score =  161 bits (81), Expect = 2e-38
 Identities = 215/260 (82%), Gaps = 6/260 (2%)
 Strand = Plus / Plus

                                                                       
Query: 28  ctagcaggttttcctaaaagggatgagagcattcatgatgcttttggagtaggacatagt 87
           |||||||| |||||||| || || || ||| | ||||||||||||||   ||| ||||||
Sbjct: 559 ctagcaggctttcctaagagagacgaaagcgtacatgatgcttttgggacagggcatagt 618

                                                                       
Query: 88  tctacaagcatatctgctgg------catggcagttgcacgtgatctattggaaaagaag 141
           |||||||| |||||||||||      ||||||||||||| | ||| || | | |||||| 
Sbjct: 619 tctacaagtatatctgctggtcttggcatggcagttgcaagggatatactaggaaagaac 678

                                                                       
Query: 142 aacaatgtaatttcagtgattggagatggagcaatgactgctgggttagcgtatgaggcc 201
           |||| ||| || |||||||| |||||||| |||||||| |||||   ||| ||||| |||
Sbjct: 679 aacagtgtcatctcagtgatcggagatggggcaatgaccgctggccaagcttatgaagcc 738

                                                                       
Query: 202 atcaacaatgcaggattccttgatactaacttgatagttgtacttaatgacaacaagcaa 261
            | ||||||||||||||||||||   |||| |||||||| ||||||| ||||||||||||
Sbjct: 739 ctgaacaatgcaggattccttgactgtaacatgatagttatacttaacgacaacaagcaa 798

                               
Query: 262 gtctctttgccaactgctac 281
           |||||||| |||||||||||
Sbjct: 799 gtctctttaccaactgctac 818


>gnl|LJGI|TC62963 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
            synthase 2 precursor; n=1; Medicago truncatula|Rep:
            1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
            Medicago truncatula (Barrel medic), partial (17%)
          Length = 702

 Score =  147 bits (74), Expect = 2e-34
 Identities = 245/302 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1290 tgtgacagttgctgatgctaggttctgcaagccattagatactgatctcattcaactact 1349
            ||||||||| |||||||| ||||| ||||| || || |||| |||||||||| | ||| |
Sbjct: 81   tgtgacagtcgctgatgcaaggttttgcaaacccttggatattgatctcattaagctatt 140

                                                                        
Query: 1350 agctaaagagcatgaagtactcattacattggaagagggttctattggaggttttgcatc 1409
             ||||| ||||| ||  |  |||| ||| ||||||| |||||||| |||||||||| |||
Sbjct: 141  ggctaaggagcacgagtttgtcatcacagtggaagaaggttctatcggaggttttggatc 200

                                                                        
Query: 1410 ccatgtttcacaattcttaagcatatctggtatccttgatggacctctgaagtggagacc 1469
             ||||||||||| ||| |||||||| ||||  |||| |||||||| |||||||||||| |
Sbjct: 201  acatgtttcacagttcctaagcatagctggcctcctggatggaccgctgaagtggagagc 260

                                                                        
Query: 1470 aatgatgcttcctgataaatatattgagcatggatctgcccaatttcagaatgaagaagc 1529
            |||||  |||||||| | ||| || |||||||||||  | |||  |||||  || |||||
Sbjct: 261  aatgacacttcctgacagatacatagagcatggatcaccacaagatcagatggatgaagc 320

                                                                        
Query: 1530 aggtctttcctcaaagcatgttgctgctacagtcttgtctcttataggaagggcaaaaga 1589
             || ||| | ||||||||| |||  || ||||||||||||||| | | |||| |||||||
Sbjct: 321  gggacttacatcaaagcatattgtagcaacagtcttgtctcttctggaaaggccaaaaga 380

              
Query: 1590 ag 1591
            ||
Sbjct: 381  ag 382