Miyakogusa Predicted Gene

Lj0g3v0167499.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0167499.1 tr|G8A0I2|G8A0I2_MEDTR F-box protein OS=Medicago
truncatula GN=MTR_103s0066 PE=4 SV=1,46.22,1.4013e-45,FBA_1,F-box
associated domain, type 1; F_box_assoc_1: F-box protein interaction
domain,F-box associa,CUFF.10486.1
         (732 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77125 weakly similar to UniRef100_A2Q228 Cluster: Cyc...   192   2e-48
gnl|LJGI|GO010439 similar to UniRef100_A2Q609 Cluster: Cyclin-li...    68   8e-11

>gnl|LJGI|TC77125 weakly similar to UniRef100_A2Q228 Cluster: Cyclin-like F-box; F-box
            protein interaction domain; n=1; Medicago truncatula|Rep:
            Cyclin-like F-box; F-box protein interaction domain -
            Medicago truncatula (Barrel medic), partial (32%)
          Length = 1362

 Score =  192 bits (97), Expect = 2e-48
 Identities = 204/240 (85%), Gaps = 6/240 (2%)
 Strand = Plus / Plus

                                                                        
Query: 405  gttaagtgagtctattgcggtgatattaaaaaatgaagaaacgacatcttttcacatatg 464
            ||||| |||||| |||||  |||||| || | |||||||||| ||| |||||||||||||
Sbjct: 889  gttaaatgagtccattgcattgatatcaatacatgaagaaacaacaacttttcacatatg 948

                                                                        
Query: 465  gattttgggtgaactcggtgtgaaggaatcatggactaaacttttcattg------ttgg 518
            |||||||||||| ||| |||  ||||||||||||||||||||||||| ||      ||||
Sbjct: 949  gattttgggtgagctctgtgcaaaggaatcatggactaaacttttcactgttggacttgg 1008

                                                                        
Query: 519  acccatgcctggcgttgcacttcctattggagtggggaagaatggtgatatattcttcag 578
            |||| ||| |||| |||  |||||||||||||| |||||||  || ||||||||||||||
Sbjct: 1009 acccttgcatggctttgggcttcctattggagtagggaagatgggcgatatattcttcag 1068

                                                                        
Query: 579  aaaagaaaatggtgaactagccttatttgatttaagtaccaacatgcttgaggagattgc 638
            |||||||||||||||||||||||| || |||||||||||  | |||||  ||||||||||
Sbjct: 1069 aaaagaaaatggtgaactagccttgttcgatttaagtactcatatgctcaaggagattgc 1128



 Score = 67.9 bits (34), Expect = 8e-11
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 157 tgggagatatatagccttagaagcaactcttggaggaaacttgata 202
           ||||| ||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 647 tgggaaatatatagcctaagaagcaactcttggaggaaactggata 692


>gnl|LJGI|GO010439 similar to UniRef100_A2Q609 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (18%)
          Length = 736

 Score = 67.9 bits (34), Expect = 8e-11
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 157 tgggagatatatagccttagaagcaactcttggaggaa 194
           ||||||||||||||||| ||||||||||||||||||||
Sbjct: 699 tgggagatatatagcctaagaagcaactcttggaggaa 736