Miyakogusa Predicted Gene

Lj0g3v0167089.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0167089.1 Non Chatacterized Hit- tr|F6H6P5|F6H6P5_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,27.54,4e-18,LRR,Leucine-rich repeat; Leucine-rich repeats, typical
(most populate,Leucine-rich repeat, typical s,CUFF.10458.1
         (2358 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63614 weakly similar to UniRef100_A7QGC3 Cluster: Chr...    62   2e-08

>gnl|LJGI|TC63614 weakly similar to UniRef100_A7QGC3 Cluster: Chromosome undetermined
            scaffold_91, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_91, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (4%)
          Length = 809

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                        
Query: 2001 tggaagaatcccatctggaacacagttgcagagctttgatggttctagttttgaagggaa 2060
            |||||||||||||  |||||||||||| ||||| |||||||  || |||| |||||| ||
Sbjct: 187  tggaagaatcccacttggaacacagttacagagttttgatgcctcaagttatgaaggaaa 246

                           
Query: 2061 tcttgatctttgtgg 2075
            |  ||||||||||||
Sbjct: 247  tgctgatctttgtgg 261