Miyakogusa Predicted Gene

Lj0g3v0166019.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0166019.1 Non Chatacterized Hit- tr|F6HHH5|F6HHH5_VITVI
Putative uncharacterized protein OS=Vitis vinifera GN=,41.07,0.0002,
,CUFF.10405.1
         (180 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV777423 similar to UniRef100_A7UU57 Cluster: AGAP00621...   357   1e-98
gnl|LJGI|TC70464                                                      357   1e-98

>gnl|LJGI|AV777423 similar to UniRef100_A7UU57 Cluster: AGAP006216-PA; n=1; Anopheles
           gambiae str. PEST|Rep: AGAP006216-PA - Anopheles gambiae
           str. PEST, partial (3%)
          Length = 597

 Score =  357 bits (180), Expect = 1e-98
 Identities = 180/180 (100%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgaggcttgcatgttttgatgtcattgcagcttgtgatgagaggtgcaaaagcagtttt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 387 atgaggcttgcatgttttgatgtcattgcagcttgtgatgagaggtgcaaaagcagtttt 328

                                                                       
Query: 61  tctcacaacctgaccctactgaaaaatgagttcggttatactaagaggcagttgagcaat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 327 tctcacaacctgaccctactgaaaaatgagttcggttatactaagaggcagttgagcaat 268

                                                                       
Query: 121 tttgttcagttggagagggatattatcagacttgaggagagttctcaaccaccaaactag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 tttgttcagttggagagggatattatcagacttgaggagagttctcaaccaccaaactag 208


>gnl|LJGI|TC70464 
          Length = 533

 Score =  357 bits (180), Expect = 1e-98
 Identities = 180/180 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggcttgcatgttttgatgtcattgcagcttgtgatgagaggtgcaaaagcagtttt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 atgaggcttgcatgttttgatgtcattgcagcttgtgatgagaggtgcaaaagcagtttt 201

                                                                       
Query: 61  tctcacaacctgaccctactgaaaaatgagttcggttatactaagaggcagttgagcaat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 tctcacaacctgaccctactgaaaaatgagttcggttatactaagaggcagttgagcaat 261

                                                                       
Query: 121 tttgttcagttggagagggatattatcagacttgaggagagttctcaaccaccaaactag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 tttgttcagttggagagggatattatcagacttgaggagagttctcaaccaccaaactag 321