Miyakogusa Predicted Gene
- Lj0g3v0165029.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0165029.1 tr|G7L5P5|G7L5P5_MEDTR Heat shock 70 kDa protein
OS=Medicago truncatula GN=MTR_7g078190 PE=3
SV=1,82.67,8e-32,HSP70_1,Heat shock protein 70, conserved site;
Actin-like ATPase domain,NULL; HEATSHOCK70,Heat shock,CUFF.10334.1
(229 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shoc... 428 e-120
gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shoc... 317 2e-86
gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shoc... 210 3e-54
gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shoc... 80 7e-15
gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shoc... 56 9e-08
gnl|LJGI|TC66924 similar to UniRef100_Q8GSN3 Cluster: Non-cell-a... 50 6e-06
gnl|LJGI|TC62922 similar to UniRef100_A7PNK8 Cluster: Chromosome... 50 6e-06
>gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (24%)
Length = 681
Score = 428 bits (216), Expect = e-120
Identities = 219/220 (99%)
Strand = Plus / Plus
Query: 1 atggctaaaaagtatgagggacctgcaataggaattgatttaggcaccacctactcatgt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 atggctaaaaagtatgagggacctgcaataggaattgatttaggcaccacctactcatgt 282
Query: 61 gttgctatatgggaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaat 120
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 gttgctatatgagaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaat 342
Query: 121 agaaccatgccttccttggttgctttcactgatacccaaagattgattggtgatgctgct 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 agaaccatgccttccttggttgctttcactgatacccaaagattgattggtgatgctgct 402
Query: 181 aaaaatcaggctgcaacaaacccgtcaaacactgtctttg 220
||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 aaaaatcaggctgcaacaaacccgtcaaacactgtctttg 442
>gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (24%)
Length = 554
Score = 317 bits (160), Expect = 2e-86
Identities = 205/220 (93%)
Strand = Plus / Plus
Query: 1 atggctaaaaagtatgagggacctgcaataggaattgatttaggcaccacctactcatgt 60
||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 94 atggccaaaaagtatgagggacctgcaataggaattgatttaggcactacctattcatgt 153
Query: 61 gttgctatatgggaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaat 120
|||||||||||| ||| |||||| ||||||||||| ||||||| |||||||||||||||
Sbjct: 154 gttgctatatggcaaggacagaataatcgagctgagatcattcccaatgaacaaggaaac 213
Query: 121 agaaccatgccttccttggttgctttcactgatacccaaagattgattggtgatgctgct 180
||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 214 agaaccactccttccttggttgctttcactgatacacaaagattaattggtgatgctgcc 273
Query: 181 aaaaatcaggctgcaacaaacccgtcaaacactgtctttg 220
||||||||||||||||||||||| ||||||||||||||||
Sbjct: 274 aaaaatcaggctgcaacaaacccatcaaacactgtctttg 313
>gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (11%)
Length = 385
Score = 210 bits (106), Expect = 3e-54
Identities = 181/206 (87%)
Strand = Plus / Plus
Query: 13 tatgagggacctgcaataggaattgatttaggcaccacctactcatgtgttgctatatgg 72
|||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||
Sbjct: 157 tatgagggacctgcaataggaattgatttaggcaccacatattcatgtgttgctgtatgg 216
Query: 73 gaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaatagaaccatgcct 132
| || ||||| || ||||||| ||||| |||||||| |||||||||||||||| ||
Sbjct: 217 caggagcagaatgatagagctgagatcatccacaatgagcaaggaaatagaaccactccc 276
Query: 133 tccttggttgctttcactgatacccaaagattgattggtgatgctgctaaaaatcaggct 192
|| || ||||||||||||||||||||||| ||||||| |||||||| ||||||||||||
Sbjct: 277 tcttttgttgctttcactgatacccaaaggctgattggagatgctgcaaaaaatcaggct 336
Query: 193 gcaacaaacccgtcaaacactgtctt 218
|| |||||||| | |||||||||||
Sbjct: 337 gccacaaacccaaccaacactgtctt 362
>gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (35%)
Length = 731
Score = 79.8 bits (40), Expect = 7e-15
Identities = 76/88 (86%)
Strand = Plus / Plus
Query: 133 tccttggttgctttcactgatacccaaagattgattggtgatgctgctaaaaatcaggct 192
||||| ||||||||||||||| ||||| |||||||||||||| ||||| |||||||||
Sbjct: 191 tcctttgttgctttcactgatgatcaaaggttgattggtgatgcagctaagaatcaggct 250
Query: 193 gcaacaaacccgtcaaacactgtctttg 220
|| |||||||| |||||||||||||
Sbjct: 251 gctacaaaccctgagaacactgtctttg 278
>gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (13%)
Length = 290
Score = 56.0 bits (28), Expect = 9e-08
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 160 agattgattggtgatgctgctaaaaatcaggctgcaacaaaccc 203
|||||| |||||||||||||||||||||| ||||| || |||||
Sbjct: 216 agattgcttggtgatgctgctaaaaatcaagctgctaccaaccc 259
>gnl|LJGI|TC66924 similar to UniRef100_Q8GSN3 Cluster: Non-cell-autonomous heat shock
cognate protein 70; n=1; Cucurbita maxima|Rep:
Non-cell-autonomous heat shock cognate protein 70 -
Cucurbita maxima (Pumpkin) (Winter squash), partial
(15%)
Length = 816
Score = 50.1 bits (25), Expect = 6e-06
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 25 gcaataggaattgatttaggcaccacctactcatgtgttgc 65
||||||||||| ||| |||||||||||||||| || |||||
Sbjct: 85 gcaataggaatcgatctaggcaccacctactcgtgcgttgc 125
>gnl|LJGI|TC62922 similar to UniRef100_A7PNK8 Cluster: Chromosome chr8 scaffold_23,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_23, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (37%)
Length = 778
Score = 50.1 bits (25), Expect = 6e-06
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 25 gcaataggaattgatttaggcaccacctactcatgtgttgc 65
||||||||||| ||| |||||||||||||||| || |||||
Sbjct: 81 gcaataggaatcgatctaggcaccacctactcgtgcgttgc 121