Miyakogusa Predicted Gene

Lj0g3v0165029.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0165029.1 tr|G7L5P5|G7L5P5_MEDTR Heat shock 70 kDa protein
OS=Medicago truncatula GN=MTR_7g078190 PE=3
SV=1,82.67,8e-32,HSP70_1,Heat shock protein 70, conserved site;
Actin-like ATPase domain,NULL; HEATSHOCK70,Heat shock,CUFF.10334.1
         (229 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shoc...   428   e-120
gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shoc...   317   2e-86
gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shoc...   210   3e-54
gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shoc...    80   7e-15
gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shoc...    56   9e-08
gnl|LJGI|TC66924 similar to UniRef100_Q8GSN3 Cluster: Non-cell-a...    50   6e-06
gnl|LJGI|TC62922 similar to UniRef100_A7PNK8 Cluster: Chromosome...    50   6e-06

>gnl|LJGI|GO034499 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (24%)
          Length = 681

 Score =  428 bits (216), Expect = e-120
 Identities = 219/220 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctaaaaagtatgagggacctgcaataggaattgatttaggcaccacctactcatgt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 atggctaaaaagtatgagggacctgcaataggaattgatttaggcaccacctactcatgt 282

                                                                       
Query: 61  gttgctatatgggaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaat 120
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 gttgctatatgagaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaat 342

                                                                       
Query: 121 agaaccatgccttccttggttgctttcactgatacccaaagattgattggtgatgctgct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 agaaccatgccttccttggttgctttcactgatacccaaagattgattggtgatgctgct 402

                                                   
Query: 181 aaaaatcaggctgcaacaaacccgtcaaacactgtctttg 220
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 aaaaatcaggctgcaacaaacccgtcaaacactgtctttg 442


>gnl|LJGI|DC598558 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (24%)
          Length = 554

 Score =  317 bits (160), Expect = 2e-86
 Identities = 205/220 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctaaaaagtatgagggacctgcaataggaattgatttaggcaccacctactcatgt 60
           ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 94  atggccaaaaagtatgagggacctgcaataggaattgatttaggcactacctattcatgt 153

                                                                       
Query: 61  gttgctatatgggaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaat 120
           |||||||||||| ||| |||||| ||||||||||| ||||||| ||||||||||||||| 
Sbjct: 154 gttgctatatggcaaggacagaataatcgagctgagatcattcccaatgaacaaggaaac 213

                                                                       
Query: 121 agaaccatgccttccttggttgctttcactgatacccaaagattgattggtgatgctgct 180
           |||||||  |||||||||||||||||||||||||| |||||||| |||||||||||||| 
Sbjct: 214 agaaccactccttccttggttgctttcactgatacacaaagattaattggtgatgctgcc 273

                                                   
Query: 181 aaaaatcaggctgcaacaaacccgtcaaacactgtctttg 220
           ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 274 aaaaatcaggctgcaacaaacccatcaaacactgtctttg 313


>gnl|LJGI|BP083571 similar to UniRef100_Q2HUD2 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (11%)
          Length = 385

 Score =  210 bits (106), Expect = 3e-54
 Identities = 181/206 (87%)
 Strand = Plus / Plus

                                                                       
Query: 13  tatgagggacctgcaataggaattgatttaggcaccacctactcatgtgttgctatatgg 72
           |||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||
Sbjct: 157 tatgagggacctgcaataggaattgatttaggcaccacatattcatgtgttgctgtatgg 216

                                                                       
Query: 73  gaagaacagaacaatcgagctgaaatcattcacaatgaacaaggaaatagaaccatgcct 132
            | || |||||  || ||||||| ||||| |||||||| ||||||||||||||||  || 
Sbjct: 217 caggagcagaatgatagagctgagatcatccacaatgagcaaggaaatagaaccactccc 276

                                                                       
Query: 133 tccttggttgctttcactgatacccaaagattgattggtgatgctgctaaaaatcaggct 192
           || || |||||||||||||||||||||||  ||||||| |||||||| ||||||||||||
Sbjct: 277 tcttttgttgctttcactgatacccaaaggctgattggagatgctgcaaaaaatcaggct 336

                                     
Query: 193 gcaacaaacccgtcaaacactgtctt 218
           || ||||||||  | |||||||||||
Sbjct: 337 gccacaaacccaaccaacactgtctt 362


>gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (35%)
          Length = 731

 Score = 79.8 bits (40), Expect = 7e-15
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 133 tccttggttgctttcactgatacccaaagattgattggtgatgctgctaaaaatcaggct 192
           ||||| |||||||||||||||   ||||| |||||||||||||| ||||| |||||||||
Sbjct: 191 tcctttgttgctttcactgatgatcaaaggttgattggtgatgcagctaagaatcaggct 250

                                       
Query: 193 gcaacaaacccgtcaaacactgtctttg 220
           || ||||||||    |||||||||||||
Sbjct: 251 gctacaaaccctgagaacactgtctttg 278


>gnl|LJGI|GO037234 similar to UniRef100_A2Q3S0 Cluster: Heat shock protein Hsp70; n=1;
           Medicago truncatula|Rep: Heat shock protein Hsp70 -
           Medicago truncatula (Barrel medic), partial (13%)
          Length = 290

 Score = 56.0 bits (28), Expect = 9e-08
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 160 agattgattggtgatgctgctaaaaatcaggctgcaacaaaccc 203
           |||||| |||||||||||||||||||||| ||||| || |||||
Sbjct: 216 agattgcttggtgatgctgctaaaaatcaagctgctaccaaccc 259


>gnl|LJGI|TC66924 similar to UniRef100_Q8GSN3 Cluster: Non-cell-autonomous heat shock
           cognate protein 70; n=1; Cucurbita maxima|Rep:
           Non-cell-autonomous heat shock cognate protein 70 -
           Cucurbita maxima (Pumpkin) (Winter squash), partial
           (15%)
          Length = 816

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 25  gcaataggaattgatttaggcaccacctactcatgtgttgc 65
           ||||||||||| ||| |||||||||||||||| || |||||
Sbjct: 85  gcaataggaatcgatctaggcaccacctactcgtgcgttgc 125


>gnl|LJGI|TC62922 similar to UniRef100_A7PNK8 Cluster: Chromosome chr8 scaffold_23,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_23, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (37%)
          Length = 778

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 25  gcaataggaattgatttaggcaccacctactcatgtgttgc 65
           ||||||||||| ||| |||||||||||||||| || |||||
Sbjct: 81  gcaataggaatcgatctaggcaccacctactcgtgcgttgc 121