Miyakogusa Predicted Gene

Lj0g3v0163249.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0163249.1 Non Chatacterized Hit- tr|I1JNH6|I1JNH6_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,56.18,7.00649e-45,no
description,Cytochrome P450; p450,Cytochrome P450; Cytochrome
P450,Cytochrome P450; seg,NULL,CUFF.10174.1
         (594 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC593900 weakly similar to UniRef100_O81973 Cluster: Cy...    72   4e-12
gnl|LJGI|TC59842 weakly similar to UniRef100_Q42798 Cluster: Cyt...    68   7e-11

>gnl|LJGI|DC593900 weakly similar to UniRef100_O81973 Cluster: Cytochrome P450 93A3;
           n=1; Glycine max|Rep: Cytochrome P450 93A3 - Glycine max
           (Soybean), partial (27%)
          Length = 584

 Score = 71.9 bits (36), Expect = 4e-12
 Identities = 90/108 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  ccttcccttgaggcaacaagagactctgaggtttcttaaagttttaaaaaataaagggga 113
           ||||||| | || ||||||||||||||| ||||||| || ||| || |||  ||||| ||
Sbjct: 437 ccttcccgttagacaacaagagactctgcggtttctgaaggttctacaaagaaaaggaga 496

                                                           
Query: 114 ggccggtgcgaccgtcgatgtcggtagcgagctcttgactctcaccaa 161
            || |||| | |||| ||||||||| |||||||||||||||| |||||
Sbjct: 497 agcaggtgaggccgttgatgtcggtggcgagctcttgactctaaccaa 544


>gnl|LJGI|TC59842 weakly similar to UniRef100_Q42798 Cluster: Cytochrome P450 93A1;
           n=1; Glycine max|Rep: Cytochrome P450 93A1 - Glycine max
           (Soybean), partial (31%)
          Length = 749

 Score = 67.9 bits (34), Expect = 7e-11
 Identities = 139/174 (79%)
 Strand = Plus / Plus

                                                                       
Query: 13  tgcatgtctgagcttcttggtagcaaaacccttcatcagcaccttcccttgaggcaacaa 72
           ||||||||||||||||| ||| ||| ||| ||  ||||    ||||||||||||||||||
Sbjct: 449 tgcatgtctgagcttctcggtggcagaacactcgatcactttcttcccttgaggcaacaa 508

                                                                       
Query: 73  gagactctgaggtttcttaaagttttaaaaaataaaggggaggccggtgcgaccgtcgat 132
           |||||||| |||||||| ||| |  | | ||  ||||| || || ||||     || |||
Sbjct: 509 gagactctcaggtttctcaaactacttagaatcaaaggtgaagctggtgaagttgttgat 568

                                                                 
Query: 133 gtcggtagcgagctcttgactctcaccaattgtgttataacaagaatgactatg 186
           || |||   ||||| ||||||||||||||| || ||||||||||||||||||||
Sbjct: 569 gttggtgctgagctattgactctcaccaatagtattataacaagaatgactatg 622