Miyakogusa Predicted Gene

Lj0g3v0161909.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0161909.1 Non Chatacterized Hit- tr|B9RSQ8|B9RSQ8_RICCO
Amine oxidase [copper-containing], putative
OS=Ricinus,36.03,4e-18,Amine oxidase N-terminal region,Copper amine
oxidase, N-terminal; no description,Copper amine
oxidas,NODE_80857_length_883_cov_10.083805.path1.1
         (408 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60675 similar to UniRef100_Q9SW88 Cluster: Amine oxid...   486   e-137

>gnl|LJGI|TC60675 similar to UniRef100_Q9SW88 Cluster: Amine oxidase; n=1; Canavalia
            lineata|Rep: Amine oxidase - Canavalia lineata, partial
            (35%)
          Length = 1237

 Score =  486 bits (245), Expect = e-137
 Identities = 362/401 (90%)
 Strand = Plus / Plus

                                                                        
Query: 8    tggaggagttgttgggggtactggaggttcccttgaagaacaaggaattcaaccgtacaa 67
            |||||||| ||| || |||||| || ||||||||||||| ||| || |||||||| || |
Sbjct: 675  tggaggagatgtgggcggtacttgacgttcccttgaagagcaatgagttcaaccgcacga 734

                                                                        
Query: 68   taagtcaacgtggtgtcaatatggcagatcttatatgtctgccagtttcttcagggtggt 127
            | | |||||| ||||||||||||||||| |||  ||| |||||| | |||||||||||||
Sbjct: 735  ttactcaacgcggtgtcaatatggcagaccttgcatgcctgccaatctcttcagggtggt 794

                                                                        
Query: 128  atgggacaccagtggaagaaaatactagatttataaaggtgcagtgtttttccaaagagg 187
            |||||||||||||||||||||| || || ||||| ||||||||||| | ||||| ||| |
Sbjct: 795  atgggacaccagtggaagaaaacacaaggtttatcaaggtgcagtgctattccagagaag 854

                                                                        
Query: 188  gcactgtgaacttctacatgaaacccattgagggggtagttgtgctggttgacatggaca 247
            |||||||||| |||||||||||||||||||||||| ||  ||||||||||||||||||||
Sbjct: 855  gcactgtgaatttctacatgaaacccattgaggggctaactgtgctggttgacatggaca 914

                                                                        
Query: 248  gaaaagaggtggtatccatttcagaaaatggcaagaatattcctgtggccaaaggcatta 307
            | ||||| |||||||||||||||||  | |||||||| ||||||||||||||||||||||
Sbjct: 915  ggaaagaagtggtatccatttcagatcaaggcaagaacattcctgtggccaaaggcatta 974

                                                                        
Query: 308  acactgactatcgttactccattcagaagctcaatggagagtttaagctagtaaatccaa 367
            ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 975  acactgactatcgctactccattcagaagctcaatggagagtttaatctagtaaatccaa 1034

                                                     
Query: 368  tatccttggaacaaccaaaaggtccaagcttcacagttgag 408
            |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1035 tatccttggaacaaccaaaaggtccaagcttcacagttgag 1075