Miyakogusa Predicted Gene

Lj0g3v0161569.1
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0161569.1 tr|Q5VSC8|Q5VSC8_DANRE Novel protein similar to
vertebrate DDHD domain containing protein 1 (DDHD1)
,32.08,0.092,seg,NULL,CUFF.10038.1
         (399 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76490                                                       72   3e-12
gnl|LJGI|BP055890 similar to UniRef100_Q95HN6 Cluster: MHC class...    64   7e-10
gnl|LJGI|BP041637                                                      58   4e-08
gnl|LJGI|BP055490 weakly similar to UniRef100_Q54LJ4 Cluster: Ty...    54   7e-07

>gnl|LJGI|TC76490 
          Length = 979

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 110 ctactgttcatccttatactacacctacaattcttaatggttcacttcaatcttcaccct 169
           |||||||||||||||||||| | ||| || ||||| ||||||||||| |||| ||||  |
Sbjct: 644 ctactgttcatccttatactcctccttcatttcttcatggttcacttgaatcatcactgt 703

                                       
Query: 170 ctcctcctctttcccatgtttcacttcc 197
           |||||| || ||| |||||||| |||||
Sbjct: 704 ctcctcttccttctcatgtttctcttcc 731



 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 150 ttcacttcaatcttcaccctctcctcctctttcccatgtttcacttccttgtcctaattc 209
           ||||||| |||| |||| ||||| ||||| |||||| | ||||||||||| | || ||||
Sbjct: 439 ttcacttgaatcatcacactctcatcctccttcccaagcttcacttccttctactcattc 498

                            
Query: 210 accttcaccaacatctc 226
           ||||| |||||| ||||
Sbjct: 499 accttaaccaacttctc 515


>gnl|LJGI|BP055890 similar to UniRef100_Q95HN6 Cluster: MHC class I chain-related
           protein A; n=4; Homo sapiens|Rep: MHC class I
           chain-related protein A - Homo sapiens (Human), partial
           (5%)
          Length = 542

 Score = 63.9 bits (32), Expect = 7e-10
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 92  ggagtgaatcctcctctcctactgttcatccttatactacacctacaattcttaatggtt 151
           ||||||| |||||  ||||||||| | ||| ||||||| | ||| ||||||||||| |||
Sbjct: 498 ggagtgactcctctcctcctactgcttatcgttatactgccccttcaattcttaatagtt 439

                                   
Query: 152 cacttcaatcttcaccctctcctc 175
           ||||  ||||||||| ||||||||
Sbjct: 438 cactggaatcttcactctctcctc 415



 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 122 cttatactacacctacaattcttaatggttcacttcaatcttcaccctctcctcctcttt 181
           |||||||| | ||| || ||||||||||||||||| ||||  ||| | |||||| || ||
Sbjct: 175 cttatactgccccttcatttcttaatggttcacttgaatcaccactcactcctcttcctt 116

                     
Query: 182 cccatgtttc 191
           ||||||||||
Sbjct: 115 cccatgtttc 106


>gnl|LJGI|BP041637 
          Length = 457

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 142 cttaatggttcacttcaatcttcaccctctcctcctctttcccatgtttcacttccttgt 201
           ||||||| ||||||| ||||   ||| |||||  || ||||||||| ||||||||||| |
Sbjct: 317 cttaatgtttcacttgaatcagaaccatctccaactttttcccatggttcacttccttct 376

                            
Query: 202 cctaattcaccttcacc 218
           ||| |||||||||||||
Sbjct: 377 cctcattcaccttcacc 393


>gnl|LJGI|BP055490 weakly similar to UniRef100_Q54LJ4 Cluster: Type A von Willebrand
           factor domain-containing protein; n=1; Dictyostelium
           discoideum|Rep:, partial (0%)
          Length = 531

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 145 aatggttcacttcaatcttcaccctctcctcctctttcccatgtttcacttcctt 199
           ||||||||||||||||| ||||| ||||   || ||||||| |||||||||||||
Sbjct: 282 aatggttcacttcaatcctcaccatctctaactttttcccaagtttcacttcctt 228