Miyakogusa Predicted Gene
- Lj0g3v0161569.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0161569.1 tr|Q5VSC8|Q5VSC8_DANRE Novel protein similar to
vertebrate DDHD domain containing protein 1 (DDHD1)
,32.08,0.092,seg,NULL,CUFF.10038.1
(399 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC76490 72 3e-12
gnl|LJGI|BP055890 similar to UniRef100_Q95HN6 Cluster: MHC class... 64 7e-10
gnl|LJGI|BP041637 58 4e-08
gnl|LJGI|BP055490 weakly similar to UniRef100_Q54LJ4 Cluster: Ty... 54 7e-07
>gnl|LJGI|TC76490
Length = 979
Score = 71.9 bits (36), Expect = 3e-12
Identities = 75/88 (85%)
Strand = Plus / Plus
Query: 110 ctactgttcatccttatactacacctacaattcttaatggttcacttcaatcttcaccct 169
|||||||||||||||||||| | ||| || ||||| ||||||||||| |||| |||| |
Sbjct: 644 ctactgttcatccttatactcctccttcatttcttcatggttcacttgaatcatcactgt 703
Query: 170 ctcctcctctttcccatgtttcacttcc 197
|||||| || ||| |||||||| |||||
Sbjct: 704 ctcctcttccttctcatgtttctcttcc 731
Score = 58.0 bits (29), Expect = 4e-08
Identities = 65/77 (84%)
Strand = Plus / Plus
Query: 150 ttcacttcaatcttcaccctctcctcctctttcccatgtttcacttccttgtcctaattc 209
||||||| |||| |||| ||||| ||||| |||||| | ||||||||||| | || ||||
Sbjct: 439 ttcacttgaatcatcacactctcatcctccttcccaagcttcacttccttctactcattc 498
Query: 210 accttcaccaacatctc 226
||||| |||||| ||||
Sbjct: 499 accttaaccaacttctc 515
>gnl|LJGI|BP055890 similar to UniRef100_Q95HN6 Cluster: MHC class I chain-related
protein A; n=4; Homo sapiens|Rep: MHC class I
chain-related protein A - Homo sapiens (Human), partial
(5%)
Length = 542
Score = 63.9 bits (32), Expect = 7e-10
Identities = 71/84 (84%)
Strand = Plus / Minus
Query: 92 ggagtgaatcctcctctcctactgttcatccttatactacacctacaattcttaatggtt 151
||||||| ||||| ||||||||| | ||| ||||||| | ||| ||||||||||| |||
Sbjct: 498 ggagtgactcctctcctcctactgcttatcgttatactgccccttcaattcttaatagtt 439
Query: 152 cacttcaatcttcaccctctcctc 175
|||| ||||||||| ||||||||
Sbjct: 438 cactggaatcttcactctctcctc 415
Score = 52.0 bits (26), Expect = 3e-06
Identities = 59/70 (84%)
Strand = Plus / Minus
Query: 122 cttatactacacctacaattcttaatggttcacttcaatcttcaccctctcctcctcttt 181
|||||||| | ||| || ||||||||||||||||| |||| ||| | |||||| || ||
Sbjct: 175 cttatactgccccttcatttcttaatggttcacttgaatcaccactcactcctcttcctt 116
Query: 182 cccatgtttc 191
||||||||||
Sbjct: 115 cccatgtttc 106
>gnl|LJGI|BP041637
Length = 457
Score = 58.0 bits (29), Expect = 4e-08
Identities = 65/77 (84%)
Strand = Plus / Plus
Query: 142 cttaatggttcacttcaatcttcaccctctcctcctctttcccatgtttcacttccttgt 201
||||||| ||||||| |||| ||| ||||| || ||||||||| ||||||||||| |
Sbjct: 317 cttaatgtttcacttgaatcagaaccatctccaactttttcccatggttcacttccttct 376
Query: 202 cctaattcaccttcacc 218
||| |||||||||||||
Sbjct: 377 cctcattcaccttcacc 393
>gnl|LJGI|BP055490 weakly similar to UniRef100_Q54LJ4 Cluster: Type A von Willebrand
factor domain-containing protein; n=1; Dictyostelium
discoideum|Rep:, partial (0%)
Length = 531
Score = 54.0 bits (27), Expect = 7e-07
Identities = 48/55 (87%)
Strand = Plus / Minus
Query: 145 aatggttcacttcaatcttcaccctctcctcctctttcccatgtttcacttcctt 199
||||||||||||||||| ||||| |||| || ||||||| |||||||||||||
Sbjct: 282 aatggttcacttcaatcctcaccatctctaactttttcccaagtttcacttcctt 228