Miyakogusa Predicted Gene

Lj0g3v0160979.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0160979.1 tr|B9NJL3|B9NJL3_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_590257 PE=4
SV=1,53,3e-19,CYSTEINE SYNTHASE,NULL; SER/THR DEHYDRATASE, TRP
SYNTHASE,NULL; no description,NULL,gene.g12328.t1.1
         (222 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60583 similar to UniRef100_A3RM06 Cluster: Cysteine s...    84   4e-16
gnl|LJGI|BP063059 homologue to UniRef100_A3RM05 Cluster: Cystein...    76   1e-13

>gnl|LJGI|TC60583 similar to UniRef100_A3RM06 Cluster: Cysteine synthase; n=1; Glycine
            max|Rep: Cysteine synthase - Glycine max (Soybean),
            complete
          Length = 1381

 Score = 83.8 bits (42), Expect = 4e-16
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                        
Query: 145  agttctggagagcgttacctatcgtcacccttgtttgaatccattaggcatgaggctgaa 204
            |||| ||||||||||||| |||| || ||  |||||||||||||||||||||| ||||||
Sbjct: 1025 agttttggagagcgttacttatcttccccactgtttgaatccattaggcatgaagctgaa 1084

                          
Query: 205  cagatgacatttga 218
            || |||||||||||
Sbjct: 1085 caaatgacatttga 1098



 Score = 56.0 bits (28), Expect = 9e-08
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                       
Query: 41  tggatgtgaatctgcttgatgaaattattcaggtatcaactgaagaagcaatagagactg 100
           ||||||| |||||  | |||||| |||||||||| |||| ||||||||| ||||| ||||
Sbjct: 840 tggatgttaatctcatagatgaagttattcaggtttcaagtgaagaagctatagaaactg 899

                                       
Query: 101 ctaatcagttaggcctgaaagaaggttt 128
           ||||   | ||| | |||||||||||||
Sbjct: 900 ctaagatgctagccttgaaagaaggttt 927


>gnl|LJGI|BP063059 homologue to UniRef100_A3RM05 Cluster: Cysteine synthase; n=1;
           Glycine max|Rep: Cysteine synthase - Glycine max
           (Soybean), partial (24%)
          Length = 465

 Score = 75.8 bits (38), Expect = 1e-13
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 145 agttctggagagcgttacctatcgtcacccttgtttgaatccattaggcatgaggctgaa 204
           |||| ||||||||||||| |||| || ||  |||||||||||||||||||||| ||||||
Sbjct: 247 agttttggagagcgttacttatcttccccactgtttgaatccattaggcatgaagctgaa 188

                         
Query: 205 cagatgacatttga 218
           |  |||||||||||
Sbjct: 187 ccaatgacatttga 174