Miyakogusa Predicted Gene
- Lj0g3v0160969.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0160969.1 Non Chatacterized Hit- tr|A5C056|A5C056_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,56.72,0.000000000000002,seg,NULL; Tryptophan synthase beta
subunit-like PLP-dependent enzymes,Tryptophan synthase beta
subun,gene.g12327.t1.1
(702 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC60583 similar to UniRef100_A3RM06 Cluster: Cysteine s... 161 7e-39
gnl|LJGI|TC73427 similar to UniRef100_A3RM03 Cluster: Cysteine s... 62 5e-09
gnl|LJGI|TC68199 homologue to UniRef100_A3RM03 Cluster: Cysteine... 62 5e-09
gnl|LJGI|TC81965 similar to UniRef100_A3RM06 Cluster: Cysteine s... 58 8e-08
>gnl|LJGI|TC60583 similar to UniRef100_A3RM06 Cluster: Cysteine synthase; n=1;
Glycine max|Rep: Cysteine synthase - Glycine max
(Soybean), complete
Length = 1381
Score = 161 bits (81), Expect = 7e-39
Identities = 183/217 (84%)
Strand = Plus / Plus
Query: 388 caatttgacaatcctgaaaacacaaagattcactatgataccactggccctgagatatgg 447
|||||||| ||||||| ||| | |||||||| ||||| |||||||||||||||||||||
Sbjct: 575 caatttgaaaatcctgcgaaccccaagattcattatgagaccactggccctgagatatgg 634
Query: 448 agagattttggagggaaagttgatgcccttgtagcaggtataggaactgggggtacaata 507
||||||| |||||||||| | |||| | || ||||| ||||||||||| || ||||||
Sbjct: 635 agagattctggagggaaaatcgatgttttcgtggcagggataggaactggaggaacaata 694
Query: 508 acaggtgcagggaaattcctcaaagagagaaacccggatatgaaggtatatggagtggaa 567
|||||||| |||| |||||||| ||||||||||| || || ||||||||||| || |||
Sbjct: 695 acaggtgctgggactttcctcaaggagagaaacccagagatcaaggtatatggtgtagaa 754
Query: 568 ccagtggaaagtgcagtcttgagtggtggacagccag 604
|| | ||||||||||| |||| ||| ||| ||||||
Sbjct: 755 cctgctgaaagtgcagttttgaatggaggaaagccag 791
>gnl|LJGI|TC73427 similar to UniRef100_A3RM03 Cluster: Cysteine synthase; n=1;
Glycine max|Rep: Cysteine synthase - Glycine max
(Soybean), complete
Length = 1510
Score = 61.9 bits (31), Expect = 5e-09
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 43 attgctgccaagttggaatcaatggaaccctgctcaagtgtcaaagacaggatag 97
|||||||| ||| ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 409 attgctgctaagctggaaatgatggaaccctgctctagtgtcaaagacaggatag 463
Score = 56.0 bits (28), Expect = 3e-07
Identities = 55/64 (85%)
Strand = Plus / Plus
Query: 460 gggaaagttgatgcccttgtagcaggtataggaactgggggtacaataacaggtgcaggg 519
||||| |||||||| ||||| | || ||||| ||||| ||||||||||||||||| |||
Sbjct: 826 gggaaggttgatgctcttgtttctgggatagggactggaggtacaataacaggtgctggg 885
Query: 520 aaat 523
||||
Sbjct: 886 aaat 889
>gnl|LJGI|TC68199 homologue to UniRef100_A3RM03 Cluster: Cysteine synthase; n=1;
Glycine max|Rep: Cysteine synthase - Glycine max
(Soybean), partial (41%)
Length = 664
Score = 61.9 bits (31), Expect = 5e-09
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 43 attgctgccaagttggaatcaatggaaccctgctcaagtgtcaaagacaggatag 97
|||||||| ||| ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 356 attgctgctaagctggaaatgatggaaccctgctctagtgtcaaagacaggatag 410
>gnl|LJGI|TC81965 similar to UniRef100_A3RM06 Cluster: Cysteine synthase; n=1;
Glycine max|Rep: Cysteine synthase - Glycine max
(Soybean), partial (38%)
Length = 641
Score = 58.0 bits (29), Expect = 8e-08
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 145 gggaagactgtccttgttgagactactagtggaaacactggaattgggttggcgttcatc 204
||||||||| | ||||||||| |||| ||||| ||||| || || ||||||||||||||
Sbjct: 464 gggaagactattcttgttgagcctacaagtggtaacaccggcatagggttggcgttcata 523
Query: 205 gcagc 209
|||||
Sbjct: 524 gcagc 528