Miyakogusa Predicted Gene

Lj0g3v0160969.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0160969.1 Non Chatacterized Hit- tr|A5C056|A5C056_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,56.72,0.000000000000002,seg,NULL; Tryptophan synthase beta
subunit-like PLP-dependent enzymes,Tryptophan synthase beta
subun,gene.g12327.t1.1
         (702 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60583 similar to UniRef100_A3RM06 Cluster: Cysteine s...   161   7e-39
gnl|LJGI|TC73427 similar to UniRef100_A3RM03 Cluster: Cysteine s...    62   5e-09
gnl|LJGI|TC68199 homologue to UniRef100_A3RM03 Cluster: Cysteine...    62   5e-09
gnl|LJGI|TC81965 similar to UniRef100_A3RM06 Cluster: Cysteine s...    58   8e-08

>gnl|LJGI|TC60583 similar to UniRef100_A3RM06 Cluster: Cysteine synthase; n=1;
           Glycine max|Rep: Cysteine synthase - Glycine max
           (Soybean), complete
          Length = 1381

 Score =  161 bits (81), Expect = 7e-39
 Identities = 183/217 (84%)
 Strand = Plus / Plus

                                                                       
Query: 388 caatttgacaatcctgaaaacacaaagattcactatgataccactggccctgagatatgg 447
           |||||||| |||||||  ||| | |||||||| ||||| |||||||||||||||||||||
Sbjct: 575 caatttgaaaatcctgcgaaccccaagattcattatgagaccactggccctgagatatgg 634

                                                                       
Query: 448 agagattttggagggaaagttgatgcccttgtagcaggtataggaactgggggtacaata 507
           ||||||| |||||||||| | ||||   | || ||||| ||||||||||| || ||||||
Sbjct: 635 agagattctggagggaaaatcgatgttttcgtggcagggataggaactggaggaacaata 694

                                                                       
Query: 508 acaggtgcagggaaattcctcaaagagagaaacccggatatgaaggtatatggagtggaa 567
           |||||||| ||||  |||||||| ||||||||||| || || ||||||||||| || |||
Sbjct: 695 acaggtgctgggactttcctcaaggagagaaacccagagatcaaggtatatggtgtagaa 754

                                                
Query: 568 ccagtggaaagtgcagtcttgagtggtggacagccag 604
           || |  ||||||||||| |||| ||| ||| ||||||
Sbjct: 755 cctgctgaaagtgcagttttgaatggaggaaagccag 791


>gnl|LJGI|TC73427 similar to UniRef100_A3RM03 Cluster: Cysteine synthase; n=1;
           Glycine max|Rep: Cysteine synthase - Glycine max
           (Soybean), complete
          Length = 1510

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 43  attgctgccaagttggaatcaatggaaccctgctcaagtgtcaaagacaggatag 97
           |||||||| ||| |||||   |||||||||||||| |||||||||||||||||||
Sbjct: 409 attgctgctaagctggaaatgatggaaccctgctctagtgtcaaagacaggatag 463



 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 460 gggaaagttgatgcccttgtagcaggtataggaactgggggtacaataacaggtgcaggg 519
           ||||| |||||||| |||||  | || ||||| ||||| ||||||||||||||||| |||
Sbjct: 826 gggaaggttgatgctcttgtttctgggatagggactggaggtacaataacaggtgctggg 885

               
Query: 520 aaat 523
           ||||
Sbjct: 886 aaat 889


>gnl|LJGI|TC68199 homologue to UniRef100_A3RM03 Cluster: Cysteine synthase; n=1;
           Glycine max|Rep: Cysteine synthase - Glycine max
           (Soybean), partial (41%)
          Length = 664

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 43  attgctgccaagttggaatcaatggaaccctgctcaagtgtcaaagacaggatag 97
           |||||||| ||| |||||   |||||||||||||| |||||||||||||||||||
Sbjct: 356 attgctgctaagctggaaatgatggaaccctgctctagtgtcaaagacaggatag 410


>gnl|LJGI|TC81965 similar to UniRef100_A3RM06 Cluster: Cysteine synthase; n=1;
           Glycine max|Rep: Cysteine synthase - Glycine max
           (Soybean), partial (38%)
          Length = 641

 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 145 gggaagactgtccttgttgagactactagtggaaacactggaattgggttggcgttcatc 204
           ||||||||| | ||||||||| |||| ||||| ||||| || || |||||||||||||| 
Sbjct: 464 gggaagactattcttgttgagcctacaagtggtaacaccggcatagggttggcgttcata 523

                
Query: 205 gcagc 209
           |||||
Sbjct: 524 gcagc 528