Miyakogusa Predicted Gene
- Lj0g3v0160079.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0160079.1 tr|G7IRM0|G7IRM0_MEDTR MYB transcription factor
OS=Medicago truncatula GN=MTR_2g089420 PE=4
SV=1,26.03,0.021,Homeodomain-like,Homeodomain-like;
Myb_DNA-binding,SANT/Myb domain; no
description,Homeodomain-like;,CUFF.9933.1
(909 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC69448 similar to UniRef100_Q0PJC1 Cluster: MYB transc... 450 e-126
gnl|LJGI|AV766688 similar to UniRef100_Q0PJC1 Cluster: MYB trans... 412 e-114
gnl|LJGI|TC75727 similar to UniRef100_Q0PJC1 Cluster: MYB transc... 188 4e-47
gnl|LJGI|TC78235 homologue to UniRef100_Q4LDB1 Cluster: Protein ... 123 2e-27
gnl|LJGI|DC598969 similar to UniRef100_Q9DVW0 Cluster: PxORF73 p... 84 2e-15
gnl|LJGI|BP077502 84 2e-15
gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome... 60 3e-08
gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB tra... 56 4e-07
>gnl|LJGI|TC69448 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
MYB122; n=1; Glycine max|Rep: MYB transcription factor
MYB122 - Glycine max (Soybean), partial (73%)
Length = 712
Score = 450 bits (227), Expect = e-126
Identities = 314/343 (91%)
Strand = Plus / Plus
Query: 1 atggcaagaacaccttcgtgtgacaaaagtggaatgaggaaaggaacttggactgcagaa 60
||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 92 atggcaagaacaccttcatgtgacaaaagtgggatgaggaaaggaacatggactgcagaa 151
Query: 61 gaagatagaaaattaattgcttatgttactaggtatggttgctggaattggcgccaactc 120
||||||| || |||||||||||||| || |||||||| |||||||| ||||||||||||
Sbjct: 152 gaagataagaagttaattgcttatgtcaccaggtatggctgctggaactggcgccaactc 211
Query: 121 cccaagtttgcaggtcttgcaaggtgtgggaagagttgcaggttgaggtggttgaattat 180
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 212 cccaagtttgcaggtcttgcaaggtgtgggaaaagttgcagattgaggtggttgaattat 271
Query: 181 ctaaggcctaatattaaaagagggaacttcactcaagaagaagaagattgcatcatcaga 240
||||||||||| || ||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 272 ctaaggcctaacatcaaaagagggaatttcactcaagaagaagaagagatcatcatcaga 331
Query: 241 atgctcaaaaagctaggcactaggtggtctgtcattgcggctgagttgccaggaagaaca 300
|||| |||||||||||||| ||| |||||| ||| || |||||||| ||||||||||||
Sbjct: 332 atgcacaaaaagctaggcaatagatggtctaccatagcagctgagttaccaggaagaaca 391
Query: 301 gataacgaagtgaagaaccattggcacaccaccctcaagagaa 343
|||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 392 gatagtgaagtcaagaaccattggcacaccaccctcaagagaa 434
Score = 135 bits (68), Expect = 5e-31
Identities = 107/120 (89%)
Strand = Plus / Plus
Query: 437 ccaaaaatggaattggttcccttcaagttactcctccaccagcaacttcaatctcagaca 496
|||||| |||||| | ||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 510 ccaaaagtggaatagcatcccttctggttactcctccaccagcaacttcaatctcaggca 569
Query: 497 gcattggtgcactgtccccgttctcatcctccagtgagttctcttgcacaacttcagatc 556
||||||||||||| ||||| |||||| |||| || |||||||| ||||||||||||||||
Sbjct: 570 gcattggtgcactatcccctttctcaacctctagcgagttctcatgcacaacttcagatc 629
Score = 69.9 bits (35), Expect = 3e-11
Identities = 55/61 (90%), Gaps = 3/61 (4%)
Strand = Plus / Plus
Query: 561 gttggtgtttgaagatgatgactttgattttctggatgcatttacagagcatgtcaatga 620
||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 655 gttggtgtttgaagatg---actttgattttctggatgattttacagagaatgtcaatga 711
Query: 621 a 621
|
Sbjct: 712 a 712
>gnl|LJGI|AV766688 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
MYB122; n=1; Glycine max|Rep: MYB transcription factor
MYB122 - Glycine max (Soybean), partial (77%)
Length = 595
Score = 412 bits (208), Expect = e-114
Identities = 313/348 (89%)
Strand = Plus / Plus
Query: 1 atggcaagaacaccttcgtgtgacaaaagtggaatgaggaaaggaacttggactgcagaa 60
||||| |||||||| || ||||||||||||||| ||||||| ||||| ||||||||||||
Sbjct: 77 atggctagaacaccatcctgtgacaaaagtggactgaggaagggaacatggactgcagaa 136
Query: 61 gaagatagaaaattaattgcttatgttactaggtatggttgctggaattggcgccaactc 120
|||||||| || |||||||||||||| ||||| ||||| |||||||| ||||||||||||
Sbjct: 137 gaagataggaagttaattgcttatgtcactagatatggctgctggaactggcgccaactc 196
Query: 121 cccaagtttgcaggtcttgcaaggtgtgggaagagttgcaggttgaggtggttgaattat 180
||||| |||||||||||||||||||||||||||||||| || ||||||||| | ||||||
Sbjct: 197 cccaaatttgcaggtcttgcaaggtgtgggaagagttgtagattgaggtggctaaattat 256
Query: 181 ctaaggcctaatattaaaagagggaacttcactcaagaagaagaagattgcatcatcaga 240
|||||||| | || ||||||||| | |||||||||||||||||||| ||||||||||
Sbjct: 257 ctaaggccagacatcaaaagagggcatttcactcaagaagaagaagagatcatcatcaga 316
Query: 241 atgctcaaaaagctaggcactaggtggtctgtcattgcggctgagttgccaggaagaaca 300
|||| |||||| ||||||| ||| |||||| |||||||||||||||| ||||||||||||
Sbjct: 317 atgcacaaaaatctaggcaatagatggtctatcattgcggctgagttaccaggaagaaca 376
Query: 301 gataacgaagtgaagaaccattggcacaccaccctcaagagaagagtt 348
||||| |||||||||||||||||||||||| |||||||||| ||||||
Sbjct: 377 gataatgaagtgaagaaccattggcacacctccctcaagaggagagtt 424
Score = 107 bits (54), Expect = 1e-22
Identities = 99/114 (86%)
Strand = Plus / Plus
Query: 442 aatggaattggttcccttcaagttactcctccaccagcaacttcaatctcagacagcatt 501
||||||||||| ||||||||||||||||||||| || | || |||||||||||||| |
Sbjct: 482 aatggaattggctcccttcaagttactcctccagcaacttctcaaatctcagacagcact 541
Query: 502 ggtgcactgtccccgttctcatcctccagtgagttctcttgcacaacttcagat 555
|||||||| || || ||||||||||| || ||||||||||||| || |||||||
Sbjct: 542 ggtgcactatctccattctcatcctctagcgagttctcttgcataagttcagat 595
>gnl|LJGI|TC75727 similar to UniRef100_Q0PJC1 Cluster: MYB transcription factor
MYB122; n=1; Glycine max|Rep: MYB transcription factor
MYB122 - Glycine max (Soybean), partial (72%)
Length = 1301
Score = 188 bits (95), Expect = 4e-47
Identities = 125/135 (92%)
Strand = Plus / Plus
Query: 1 atggcaagaacaccttcgtgtgacaaaagtggaatgaggaaaggaacttggactgcagaa 60
||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 111 atggcaagaacaccttcatgtgacaaaagtgggatgaggaaaggaacatggactgcagaa 170
Query: 61 gaagatagaaaattaattgcttatgttactaggtatggttgctggaattggcgccaactc 120
||||||| || |||||||||||||| || |||||||| |||||||| ||||||||||||
Sbjct: 171 gaagataagaagttaattgcttatgtcaccaggtatggctgctggaactggcgccaactc 230
Query: 121 cccaagtttgcaggt 135
|||||||||||||||
Sbjct: 231 cccaagtttgcaggt 245
Score = 178 bits (90), Expect = 4e-44
Identities = 127/137 (92%), Gaps = 3/137 (2%)
Strand = Plus / Plus
Query: 129 tgcaggtcttgcaaggtgtgggaagagttgcaggttgaggtggttgaattatctaaggcc 188
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 355 tgcaggtcttgcaaggtgtgggaaaagttgcagattgaggtggttgaattatctaaggcc 414
Query: 189 taatattaaaagagggaacttcactcaagaagaagaagattgcatcatcagaatgctcaa 248
||| || ||||||||||| |||||||||||||||| |||| |||||||||||||| |||
Sbjct: 415 taacatcaaaagagggaatttcactcaagaagaag-agat--catcatcagaatgcacaa 471
Query: 249 aaagctaggcactaggt 265
||||||||||| |||||
Sbjct: 472 aaagctaggcaataggt 488
Score = 127 bits (64), Expect = 1e-28
Identities = 106/120 (88%)
Strand = Plus / Plus
Query: 437 ccaaaaatggaattggttcccttcaagttactcctccaccagcaacttcaatctcagaca 496
|||||| |||||| | ||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 761 ccaaaagtggaatagcatcccttctggttactcctccaccagcaacttcaatctcaggca 820
Query: 497 gcattggtgcactgtccccgttctcatcctccagtgagttctcttgcacaacttcagatc 556
||||||||||||| ||||| |||||| |||| || ||||| || ||||||||||||||||
Sbjct: 821 gcattggtgcactatcccctttctcaacctctagggagttttcatgcacaacttcagatc 880
Score = 105 bits (53), Expect = 5e-22
Identities = 77/85 (90%)
Strand = Plus / Plus
Query: 632 cagagctgcaaattgatactaattatgctcctcaaaatcaagacactaccgagatccttg 691
|||||||||||||||| ||||||| ||||| ||||||||||||| || | |||||||||
Sbjct: 1022 cagagctgcaaattgagactaattgtgctcttcaaaatcaagacgatatccagatccttg 1081
Query: 692 atgcttgtgcattgtctcccaatca 716
||||||||| |||||||||||||||
Sbjct: 1082 atgcttgtgaattgtctcccaatca 1106
Score = 97.6 bits (49), Expect = 1e-19
Identities = 69/75 (92%), Gaps = 3/75 (4%)
Strand = Plus / Plus
Query: 561 gttggtgtttgaagatgatgactttgattttctggatgcatttacagagcatgtcaatga 620
||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||
Sbjct: 906 gttggtgtttgaagatg---actttgattttctggatgattttacagagaatgtcaatga 962
Query: 621 aaatttctggtcaga 635
|||||||||||||||
Sbjct: 963 aaatttctggtcaga 977
Score = 95.6 bits (48), Expect = 5e-19
Identities = 60/64 (93%)
Strand = Plus / Plus
Query: 280 gctgagttgccaggaagaacagataacgaagtgaagaaccattggcacaccaccctcaag 339
|||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct: 622 gctgagttaccaggaagaacagatagtgaagtcaagaaccattggcacaccaccctcaag 681
Query: 340 agaa 343
||||
Sbjct: 682 agaa 685
>gnl|LJGI|TC78235 homologue to UniRef100_Q4LDB1 Cluster: Protein recA; n=1;
Lactobacillus farciminis|Rep: Protein recA -
Lactobacillus farciminis, partial (6%)
Length = 409
Score = 123 bits (62), Expect = 2e-27
Identities = 178/219 (81%), Gaps = 12/219 (5%)
Strand = Plus / Plus
Query: 670 caagacactaccgagatccttgatgcttgtgcattgtctcccaatcaatc---------- 719
|||||||||||| |||| ||||||||||||||||| ||||| ||||||||
Sbjct: 1 caagacactacccagattcttgatgcttgtgcattatctccgaatcaatcgtccagccca 60
Query: 720 --tttggtccttgagaatgaatttggcagccttctggatgcacttacagagccagcaatt 777
||||| ||||| |||| || |||| | ||||||||||| ||||| ||| |||||
Sbjct: 61 agtttggctcttgataatgccttgggcaactttctggatgcaaacacagatccaacaatt 120
Query: 778 gataacttttggggacagccatatgtgactgacacgtgctatgtgcctgaatctgaatat 837
||||| |||||||||||||||||||| |||||||||| || || | ||||||||||||||
Sbjct: 121 gataatttttggggacagccatatgttactgacacgtcctttgcggctgaatctgaatat 180
Query: 838 tactctacaatatatgatgcagatctttggagtcaaagt 876
| |||| | ||| ||||||||||||||||||||||||
Sbjct: 181 ttttctataggatacgatgcagatctttggagtcaaagt 219
>gnl|LJGI|DC598969 similar to UniRef100_Q9DVW0 Cluster: PxORF73 peptide; n=1; Plutella
xylostella granulovirus|Rep: PxORF73 peptide - Plutella
xylostella granulovirus, partial (35%)
Length = 1000
Score = 83.8 bits (42), Expect = 2e-15
Identities = 169/210 (80%), Gaps = 1/210 (0%)
Strand = Plus / Plus
Query: 1 atggcaagaacaccttcgtgtgacaaaagtggaatgaggaaaggaacttggactgc-aga 59
||||||||||||||||| |||||||||| ||| |||| |||| || |||||| ||| ||
Sbjct: 41 atggcaagaacaccttcatgtgacaaaattgggatgacgaaacgaccttggagtgcggga 100
Query: 60 agaagatagaaaattaattgcttatgttactaggtatggttgctggaattggcgccaact 119
||| ||| || |||| ||||||||| ||| ||||| ||||| ||||| | || |||
Sbjct: 101 ggaacatacgaacttaactgcttatgtccctacatatggctgctgcaattgccccccact 160
Query: 120 ccccaagtttgcaggtcttgcaaggtgtgggaagagttgcaggttgaggtggttgaatta 179
|||||| |||||||||||||| | | ||| || | || || |||| ||||| ||||||
Sbjct: 161 ccccaactttgcaggtcttgccacgcgtgcaaacacttccacattgacgtggtcgaatta 220
Query: 180 tctaaggcctaatattaaaagagggaactt 209
||||| ||||||||| ||||| |||||||
Sbjct: 221 tctaacgcctaatatccaaagacggaactt 250
>gnl|LJGI|BP077502
Length = 372
Score = 83.8 bits (42), Expect = 2e-15
Identities = 143/177 (80%), Gaps = 6/177 (3%)
Strand = Plus / Minus
Query: 720 tttggtccttgagaatgaatttggcagccttctggatgcacttacagagccagcaattga 779
|||||| ||||| ||||| || ||||| |||| |||||| ||||| ||| |||||||
Sbjct: 343 tttggttcttgataatgacttgggcagttttctagatgcaaacacagacccaacaattga 284
Query: 780 taacttttggggacagccatatgtgactgacacgtgctatgtgcctgaatctgaatatta 839
| | |||||| ||||||||||||| || ||||||| || || | |||||||||||||||
Sbjct: 283 tgatttttggagacagccatatgttacagacacgtcctttgcggctgaatctgaatattt 224
Query: 840 ctctacaatatatgatgc------agatctttggagtcaaagtactttgtatgatga 890
|||||| |||| ||||| ||||||||||||||||||| |||||| |||||
Sbjct: 223 ttctacagtatacgatgctgcagatgatctttggagtcaaagtaatttgtacgatga 167
>gnl|LJGI|TC58575 similar to UniRef100_A7QY25 Cluster: Chromosome undetermined
scaffold_237, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_237,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (63%)
Length = 799
Score = 60.0 bits (30), Expect = 3e-08
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagttgcaggttgaggtggttgaattatctaaggcctaatattaaaaga 201
|||||||||||||||||||| ||||| |||||||| || || || || ||||| || |||
Sbjct: 177 aggtgtgggaagagttgcagattgagatggttgaactacctgagacccaatatcaagaga 236
Query: 202 gggaac 207
||||||
Sbjct: 237 gggaac 242
>gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB transcription factor
MYB160; n=1; Glycine max|Rep: MYB transcription factor
MYB160 - Glycine max (Soybean), partial (60%)
Length = 351
Score = 56.0 bits (28), Expect = 4e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagttgcaggttgaggtggttgaattatctaaggcct 189
|||||||||||||| ||||||||||||||| | ||||| || ||||||
Sbjct: 114 aggtgtgggaagagctgcaggttgaggtggataaattacctgaggcct 161